Skip to main content

We narrowed to 16,183 results for: GRN

Showing: 681 - 700 of 16183 results
  1. p426_Cas9_gRNA-ARS308a

    Plasmid
    #87384
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  2. U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2

    Plasmid
    #214814
    Purpose
    A single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATM
    Depositor
    Insert
    St1Cas9 CNRZ1066 v2 targeting ATM (ATM Human)
    Use
    CRISPR
    Expression
    Mammalian
    Promoter
    CAG
    Available Since
    Feb. 16, 2024
    Availability
    Academic Institutions and Nonprofits only
  3. pPbuCas13b-gRNA-NT

    Plasmid
    #184568
    Purpose
    Constitutive expression of single-spacer CRISPR array with non-targeting spacer for PbuCas13b in bacteria.
    Depositor
    Insert
    Constitutive expression of single-spacer CRISPR array witha nontargeting spacer for PbuCas13b in bacteria.
    Use
    CRISPR and Synthetic Biology
    Expression
    Bacterial
    Promoter
    J23119
    Available Since
    Oct. 6, 2022
    Availability
    Academic Institutions and Nonprofits only
  4. p426_Cas9_gRNA-HIS3b

    Plasmid
    #87402
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  5. p426_Cas9_gRNA-ARS1309a

    Plasmid
    #87399
    Purpose
    All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.
    Insert
    Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
    Use
    CRISPR
    Promoter
    ADH1, pTyrosine
    Available Since
    April 5, 2017
    Availability
    Academic Institutions and Nonprofits only
  6. pC1300_pUB10_pco-nCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10

    Plasmid
    #197981
    Purpose
    T-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by UBQ10 gene promoter, flanked by ribozymes.
    Depositor
    Inserts
    pco-nCasphi-2
    AtPDS3 gRNA10
    Use
    CRISPR
    Expression
    Plant
    Promoter
    pUBQ10
    Available Since
    March 30, 2023
    Availability
    Academic Institutions and Nonprofits only
Showing: 681 - 700 of 16183 results