We narrowed to 14,412 results for: sgRNA
-
Plasmid#62315PurposesgRNA with 2x MS2 (wt+f6) for yeast cellsDepositorInsertsgRNA + 2x MS2 (wt+f6) binding module
ExpressionYeastPromoterSNR52Available SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSmart-Nm-sgRNA-BbsI
Plasmid#49157PurposePlasmid for cloning spacer into sgRNA for NmCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
psgRNA
Plasmid#114005Purposeexpress sgRNA. ColE1, KanDepositorInsertgRNA
PromoterBBa_J23119Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCFD3.1-w-dU6:3gRNA
Plasmid#123366PurposegRNA expression plasmid for CRISPR mutagenesis in Drosophila (with mini-white transformation marker).DepositorInsertU6:3-gRNA
UseCRISPRExpressionInsectAvailable SinceApril 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1
Plasmid#75388PurposesgRNA1DepositorInsertsgRNA1
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterU6Available SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-1sgRNA
Plasmid#64239Purposedestination vector for one U6x:sgRNA cassetteDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEJS887_pTetR-P2A-BFPnls/sgAlpha
Plasmid#108651PurposeAlpha satellite repeats targeting Spy sgRNA under U6 promoterDepositorInsertsAlpha satellite repeats targeting sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN-OR-MalT-3NT
Plasmid#62309Purposesynthetic circuit: OR gate, the sgRNA used for the NOT gate was substituted with one designed to target the malT gene in the E. coli genomeDepositorInsertsA2NT sgRNA
Malt-3NT sgRNA
A2NT sgRNA
UseCRISPRExpressionBacterialPromoterPA2, PPhlF, and pBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-msCAMK2d-sgRNA-cTNT-SaCas9-HA-OLLAS
Plasmid#209782PurposeExpresses SaCas9 by the specific cTNT promoter and sgRNA targeted the mouse Camk2d gene by U6 promoterDepositorInsertsgRNA
UseAAVTagsHA and OLLASPromotercTNTAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
sgRNA 1 GAPDH
Plasmid#83808PurposeExpress Sg-1 sgRNA targeting GAPDHDepositorInsertSgRNA
UseCRISPRAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBluescriptSKII+ U6-sgRNA(F+E) ACTB
Plasmid#74705PurposeEncodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and a spacer targeting the 3'UTR of ACTB mRNADepositorInsertU6 promoter driving sgRNA targeting the 3'UTR of ACTB mRNA
UseCRISPRExpressionMammalianAvailable SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_cpaA- Pconstitutive-sgRNA(Sth3)_blaA
Plasmid#133347Purposeexpression of two sgRNA from Streptococcus thermophilus #3 each express from its own constitutive promoter; here first one targets cpaA and second one targets blaA (from Caulobacter crescentus)DepositorInsertsgRNA_cpaA and sgRNA_blaA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6-AsCas12f-sgRNA-v2
Plasmid#204639PurposeExpression of trancated AsCas12f sgRNA in mammalian cellsDepositorInserttrancated AsCas12f sgRNA (sgRNA-v2)
ExpressionMammalianPromoterU6Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingExpressionMammalianPromoterU1a and U6Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti SpBsmBI sgRNA Puro
Plasmid#62207PurposeAn empty sgRNA expression vector for expression of sgRNA for Sp Cas9 (3rd generation lentiviral vector)DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterU6Available SinceMay 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adra1b
Plasmid#184293PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adra1bDepositorInsertssgRNA-Adra1b
sgRNA-Adra1b
UseAAV and CRISPRExpressionMammalianAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA-gRic6T
Plasmid#106401PurposeE.coli-Pseudomonas putida KT2440 shuttle plasmid containing sgRNA targeting the KT2440 genome, and homologous arms.DepositorInsertsgRNA
ExpressionBacterialPromoterpj23119Available SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN-OR
Plasmid#62307Purposesynthetic circuit: OR gateDepositorInsertsA2NT sgRNA
A4NT sgRNA
A2NT sgRNA
UseCRISPRExpressionBacterialPromoterPA2, PPhlF, and pBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only