We narrowed to 8,392 results for: crispr grnas
-
Plasmid#221550PurposeExpresses Cas9 and gRNA for disruption of TBK1 gene in human cellsDepositorAvailable SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only
-
783-Rx-mU6: RfxCas13d gRNA and array cloning backbone
Plasmid#228361PurposemU6-driven expression of RfxCas13d gRNAs and arrays. Contains AarI sites for guide cloning.DepositorTypeEmpty backboneUseCRISPR and Lentiviral; Rfxcas13d grna expression …ExpressionMammalianPromotermU6Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSelect-7
Plasmid#190244PurposeEncodes lacI- and pheA-targeting gRNAs for positive and negative selections of dCas9 activity.DepositorInsertLacI
ExpressionBacterialAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSelect-9
Plasmid#190245PurposeEncodes lacI- and aadA-targeting gRNAs for positive and negative selections of dCas9 activity.DepositorInsertLacI
ExpressionBacterialAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
KK701: pMAGIC (L3-L2) 3x HA eptitope tag + polyA; hU6::xCas9(3.7) gRNA scaffold
Plasmid#121842PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven xCas9(3.7) gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA fusion to dCas9 w/ gRNA expressionDepositorTypeEmpty backboneUseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35s:dCas:VP64:tNos (GB1189)
Plasmid#75403PurposeTranscriptional unit of (human codon optimized) inactivated Cas9 fused to the VP64 Transcriptional ActivatorDepositorInsertdCas:VP64
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB9P2
Plasmid#210030PurposeContains PE2 prime editing gRNA cloning site, inducible prime editor 2, rtTA-T2A-puroDepositorInsertsprime editor 2
rtta-T2A-puro
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB1163
Plasmid#210032PurposeContains Cas3 gRNA cloning site, inducible Cas11-P2A-Cas6-T2A-Cas3, rtTA-T2A-blastDepositorInsertsCas11-P2A-Cas6-T2A-Cas3
rtta-T2A-blast
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMB1052:miniTol2-U6-(empty)SaCas9_gRNA-CAG-Cre-P2A-NeoR-WPRE
Plasmid#168108PurposeTol2 transposon vector of empty U6-S.aureus Cas9 gRNA cassette and CAG-driven Cre-NeoRDepositorTypeEmpty backboneUseCRISPR and Cre/LoxAvailable SinceJuly 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_26G
Plasmid#91149PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:barDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21B
Plasmid#91129PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9_dead + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9_dead + AtU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
(565) pAAV Alb-AAT KRAB-SadCas9 U6-gSTOP
Plasmid#163030PurposeExpression of CRISPRi with gSTOP gRNADepositorInsertMammalian codon-optimized SadCas9
UseAAVTagsKRAB, SV40 pA, and myc NLSExpressionMammalianPromoterAlb-AATAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH49
Plasmid#128211Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2518
Plasmid#91087PurposeModule C, Promoter: TaU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterTaU6Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCJH026_proD_Cas12c-multiplexing_CAM
Plasmid#183073PurposePlasmid expressing a Cas12c sgRNA targeting GFP and another sgRNA targeting RFP in one transcript for testing multiplexed repressionDepositorInsertExpressing two Cas12c sgRNAs (targeting GFP or RFP) in one transcript
UseCRISPRExpressionBacterialAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
BlatCas9
Plasmid#163792PurposeThe plasmid expresses human codon-optimized BlatCas9 and gRNA expression elements.DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS423-TyrSgH
Plasmid#163973PurposeHelper plasmid for cloning gRNAs under the control of the tRNA(Tyr) promoterDepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS423-SgH
Plasmid#163972PurposeHelper plasmid for cloning gRNAs under the control of the SNR52 promoter.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SOX2_v32_7-4)-PGKpuroBFP-W
Plasmid#211986PurposeExpress gRNA against SOX2 with puro and BFPDepositorInsertsgRNA targeting SOX2 (SOX2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only