We narrowed to 16,291 results for: grna
-
Plasmid#86351PurposeEncodes gRNA for 3' target of human ARID5BDepositorInsertgRNA against ARID5B (ARID5B Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPG_1
Plasmid#86344PurposeEncodes gRNA for 3' target of human CEBPGDepositorInsertgRNA against CEBPG (CEBPG Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPA_2
Plasmid#86359PurposeEncodes gRNA for 3' target of human CEBPADepositorInsertgRNA against CEBPA (CEBPA Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX330_MED13_iso1_1
Plasmid#135751PurposeEncodes gRNA for 3' target of human MED13_iso1DepositorAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPG_2
Plasmid#86345PurposeEncodes gRNA for 3' target of human CEBPGDepositorInsertgRNA against CEBPG (CEBPG Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6a-T
Plasmid#117209PurposeExpresses gRNA in Aedes aegyptiDepositorInsertu6a promoter-gRNA
UseSynthetic BiologyExpressionInsectPromoterU6Available SinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6d
Plasmid#117224PurposeExpresses gRNA in Aedes aegyptiDepositorInsertHR U6d promoter-gRNA
UseSynthetic BiologyExpressionInsectPromoterU6Available SinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6a
Plasmid#117221PurposeExpresses gRNA in Aedes aegyptiDepositorInsertHR U6a promoter-gRNA
UseSynthetic BiologyExpressionInsectPromoterU6Available SinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_GATAD1_2
Plasmid#104043PurposeEncodes gRNA for 3' target of human GATAD1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_GATAD1_1
Plasmid#104042PurposeEncodes gRNA for 3' target of human GATAD1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_erbb2_cmlc2-nmKate
Plasmid#238409PurposeDrives expression of 3 different gRNAs targeting erbb2, and expression of nuclear mKate in cardiomyocytesDepositorInsertnuclear mKate/3 gRNAs targeting tnnt2a
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol1-U6abc_amhc(myh6)_cmlc2-nmKate
Plasmid#238375PurposeDrives expression of 3 different gRNAs targeting amhc (myh6), and expression of nclear mKate in cardiomyocytes.DepositorInsertnuclear mKate/3 gRNAs targeting amhc
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-Csy4
Plasmid#161760PurposeMODULE B Csy4 vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2103 - #91061)DepositorInsertgRNAs
ExpressionBacterialPromoterCmYLCV PromoterAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
U6d-T
Plasmid#117212PurposeExpresses gRNA in Aedes aegyptiDepositorInsertu6d promoter-gRNA
UseSynthetic BiologyExpressionInsectPromoterU6Available SinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
LRG-2.1T-sgTAF12(human)#4.5
Plasmid#105987Purposelentivirally express gRNA targeting human TAF12 HFD with GFP markerDepositorInsertgRNA targeting human TAF12-HFD
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_MIER3_2
Plasmid#86324PurposeEncodes gRNA for 3' target of human MIER3DepositorInsertgRNA against MIER3 (MIER3 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM3A_1
Plasmid#86321PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_HMG20A_2
Plasmid#86319PurposeEncodes gRNA for 3' target of human HMG20ADepositorInsertgRNA against HMG20A (HMG20A Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only