We narrowed to 25,285 results for: crispr
-
Plasmid#184565PurposeInducible expression of PbuCas13b nuclease in bacteria.DepositorInsertCas13b nuclease from Prevotella buccae
ExpressionBacterialPromoterT7 promoterAvailable sinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRU51
Plasmid#167677PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRU52
Plasmid#167678PurposeFinal destination vector for single Gateway LR reactionDepositorInsertPcUB4-2::spCas9
UseCRISPRAvailable sinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS74 (synthetic guide::∆HYGR::unc-54 3' UTR^SEC)
Plasmid#154838PurposeInsertion of split hygromycin landing pad into ChrII:8420157 site C. elegans strains via CRISPR with SEC selectionDepositorInsertsynthetic guide::∆HYGR::unc-54 3' UTR
UseCRISPR and Cre/LoxExpressionWormMutation∆HYGR is promoterless and encodes aa 60-341Available sinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
H517 SONIC HRASV12 donor
Plasmid#138177PurposeCRISPR SONIC: HRAS G12V donor plasmidDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHRASV12 (HRAS Human)
UseNhej donorAvailable sinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCfB5191
Plasmid#126911PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiaeDepositorInsertX-4 and XII-5 gRNA
UseCRISPRAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-T3-CjCAS9-pA
Plasmid#131543PurposeExpresses Campylobacter jejuni-derived Cas9 nuclease in mammalian cells. Used to modify genome of mouse embroysDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCjCas9
UseCRISPRTagsFLAG-SV40NLS, SV40NLS, and polyAExpressionMammalianMutationHuman codon-optimizedPromoterCAG, T3Available sinceNov. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0013
Plasmid#117549PurposeLevel 1 Golden Gate Cassette: LbCas12a expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + LbCas12a (with stop codon) (pEPOR0SP0007)+ Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available sinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
pDECKO_TFRC_C (with mCherry)
Plasmid#72627PurposeExpresses two gRNAs targeting the TFRC promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNAs toward TFRC
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available sinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Neg
Plasmid#61856PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, negative strandDepositorAvailable sinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Pos
Plasmid#61857PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, positive strandDepositorAvailable sinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_47
Plasmid#60071PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available sinceOct. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpRY-P2A-EGFP (BKS428)
Plasmid#223125PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpRY with C-term BPNLS-P2A-EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman codon optimized TadCBEd-SpRY-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpRY=D10A/A61R/L1111R/D1135L…PromoterCMV and T7Available sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMYT095
Plasmid#198866PurposeCRISPR/Cas9 Vector with URA3 selectable marker to be used in the Ellis MYT systemDepositorTypeEmpty backboneUseSynthetic BiologyAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRAU168
Plasmid#86834Purposebacterial expression of anti-CRISPR protein AcrIIA1DepositorInsertacrIIA1
ExpressionBacterialPromoteraraBADAvailable sinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA098
Plasmid#245320PurposeCas9 CRISPRko all-in-one positive control; targets CD47DepositorAvailable sinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-CENPA
Plasmid#227282PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of CENPA for knock-in.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA Targeting N-terminus of CENPA (CENPA Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only