We narrowed to 41,416 results for: lat
-
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-S5E2-GCaMP6f
Plasmid#135632PurposeAAV vector to drive the expression of GCaMP6f in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGCaMP6f
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E29-ChR2GFP2x
Plasmid#153437PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E29 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N E4orf1
Plasmid#38063DepositorInsertE4 orf1
UseRetroviralTagsFlag and HAExpressionMammalianPromoterPKGAvailable SinceAug. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-dTom-nlsdTom
Plasmid#135630PurposeAAV vector to drive the expression of dTomato in PV cortical interneurons under the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTwist-CMV-HDGFL2_Cryptic_TwinstrepTEV_6xHis
Plasmid#232344PurposeExpresses human HDGFL2 protein with TDP-43 regulated cryptic exon, along with an N-terminal twinstrep tag + TEV protease site and C-terminal His-tagDepositorInsertHDGF Like 2 (HDGFL2 Human)
TagsGGGS linker, 6xHis and Twin-strep, TEV protease s…ExpressionMammalianMutationTDP-43 regulated cryptic exonAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N E3gp 19k
Plasmid#38049DepositorInsertE3 gp19K
UseRetroviralTagsFlag and HAExpressionMammalianPromoterPKGAvailable SinceAug. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N EBNA3A
Plasmid#37956DepositorInsertEBNA3A (EBNA-3A H. Herpesvirus 4 (EBV))
UseRetroviralTagsFlag and HAExpressionMammalianPromoterPKGAvailable SinceAug. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR
Plasmid#60231PurposeExpresses Cre recombinase and KASH-tagged EGFP from the hSyn promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Cre recombinase
EGFP
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HA-P2A and EGFP-KASHExpressionMammalianPromoterU6 and hSynAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-EGFP (ANV)
Plasmid#71685PurposeExpression of mutant human codon-optimized dCas9-DNMT3A fusion (inactive catalytic domain of DNMT3A) with T2A-EGFP; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the inactivated (E756A) catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-EGFP (DNMT3A Human, Synthetic, S. pyogenes)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E756A inactiva…PromoterCBhAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GFP-fGFP
Plasmid#135631PurposeAAV vector to drive the expression of fGFP in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGFP-fGFP
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn-PdCO-mScarlet-WPRE
Plasmid#198510PurposeExpresses optimized PdCO in frame with mScarlet under control of human synapsin1 promotor.DepositorHas ServiceAAV1 and AAV5InsertPdCO
UseAAVTagsRho1D4 and mScarletExpressionMammalianPromoterhSyn1Available SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N GFP
Plasmid#37855DepositorInsertGFP
UseRetroviralTagsFlag and HAExpressionMammalianPromoterPKGAvailable SinceSept. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N BALF1
Plasmid#37921DepositorAvailable SinceSept. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
MSCV-C 18E6
Plasmid#37884DepositorAvailable SinceJuly 26, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa(0.4)-PdCO-mScarlet-WPRE
Plasmid#198508PurposeExpresses optimized PdCO in frame with mScarlet under control of minimal CamKIIa promotor.DepositorInsertPdCO
UseAAVTagsRho1D4 and mScarletExpressionMammalianPromoterCaMKIIα minimal promotor (0.4kb)Available SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
Plasmid#60226PurposeExpresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Renilla luciferase
Cre recombinase
UseAAV, CRISPR, Cre/Lox, Luciferase, and Mouse Targe…TagsCre-HA and Rluc-P2AExpressionMammalianPromoterEFS and U6Available SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N 16E6
Plasmid#37875DepositorAvailable SinceJuly 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn-DIO-PdCO-mScarlet-WPRE
Plasmid#198511PurposeExpresses optimized PdCO in frame with mScarlet under control of human synapsin1 promotor after Cre-dependent recombination.DepositorHas ServiceAAV1 and AAV5InsertPdCO
UseAAV and Cre/LoxTagsRho1D4 and mScarletExpressionMammalianPromoterhSyn1Available SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only