We narrowed to 7,858 results for: Tet-on
-
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-mGFAP-Lck-PinkFlamindo
Plasmid#228394PurposeAAV vector to express the red cAMP indicator in astrocytesDepositorInsertPink Flamindo
UseAAVPromotermGFAPAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-Sox10
Plasmid#36978DepositorAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 3xFlag IFIT3
Plasmid#53553Purposemammalian expression of IFIT3DepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-DIO-Lck-mCherry-ibARK-4x6T
Plasmid#241243PurposeCre-dependent expression plasma membrane-tethered ibARK with higher specificity in astrocytesDepositorInsertDIO-Lck-mCherry-ibARK-4x6T
UseAAVAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVTRE3_Clover
Plasmid#135179PurposeAAV expression of TRE(TRE3G)-driven, Clover expression for fluorescent lablingDepositorInsertsClover
TRE3G
UseAAVExpressionMammalianMutationa variant of GFPPromoterTRE3GAvailable SinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131-STU-Lb
Plasmid#138096PurposeGolden Gate entry vector for 1st crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9HF1-recA56
Plasmid#89962PurposeModified from pEM-Cas9HF1 (Addgene ID: 89961) to include constitutive recA56 to block recA-mediated double-strand break repair.DepositorInsertsCas9HF1
recA56
ExpressionBacterialMutationN497A/R661A/Q695A/Q926APromoterpTet and proDAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-STU-Lb
Plasmid#138105PurposeGolden Gate entry vector for 4th crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-STU-Lb
Plasmid#138102PurposeGolden Gate entry vector for 3rd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-STU-Lb
Plasmid#138099PurposeGolden Gate entry vector for 2nd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCI-TPI_WT-4MS2-xrRNA-4H
Plasmid#108371PurposeExpresses wild type TPI reporter; enables detection of 5'-3' decay intermediates (xrFrag); 4MS2 tethering sites upstream of xrRNA and allows detection via northern blot (4H binding sites)DepositorInsertWild type TPI reporter with 4MS2 binding sites upstream of MVE xrRNA and 4H probe binding sites (TPI1 Human)
ExpressionMammalianPromoterCMVAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1_Cre
Plasmid#201198PurposeAAV vector for cre expression under EF1 promoterDepositorInsertscre
EF1alpha promoter
UseAAVExpressionBacterial and MammalianMutationnuclear targeting crePromoterN/A and hEF1alpha promoterAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCP60 RS-GFP
Plasmid#122173Purpose"Binary vector for Agrobacterium tumefacience-mediated transformation of plant cells resulting in constitutive expression of cytoplasmatically localized RS-GFP"DepositorInsertRS-GFP
UseBinary vector for escherichia coli and agrobacter…ExpressionPlantPromoterCaMV 35SAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTCas9_scr
Plasmid#207566PurposeThermoCas9-mediated cleavage of genomic DNA in E. coliDepositorInsertPlac/tet_ThermoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationWild-typeAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDule-3-nitroTyrosine (5B)
Plasmid#85498PurposePlasmid for incorporating the non-canonical amino acid 3-nitroTyrosine with the Mj 3NY (5B) synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsert3-nitroTyrosine tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
TagsNoneExpressionBacterialMutationY32H H70C D158S I159A L162RPromoterlpp (constitutive)Available SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-TeNT-P2A-EGFP
Plasmid#176282PurposeViral vector for co-expression of TeNT and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertTeNT-P2A-EGFP
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9HF1
Plasmid#89961PurposeModified from pCas9-CR4 (Addgene: 62655) to use the high-fidelity version of Cas9, SpCas9-HF1 (N497A/R661A/Q695A/Q926A) from Kleinstiver et al 2016.DepositorInsertCas9HF1
ExpressionBacterialMutationN497A/R661A/Q695A/Q926APromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Puro_siKO-2TO
Plasmid#86697PurposeTetracycline inducible (2TO version) expression of guide RNA targeted to AAVS1 locusDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterH1 2TOAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp16-HF
Plasmid#157725Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp16 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits