We narrowed to 16,291 results for: grna
-
Plasmid#154890PurposeHuman BRD4 CRISPRi gRNADepositorInsertBRD4-targeting gRNA
UseCRISPR and LentiviralAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right}
Plasmid#184381PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, two gRNAs targeting dystrophin
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_sgGFP3
Plasmid#119875PurposegRNA expression vectorDepositorInsertsgGFP
UseLentiviralExpressionMammalianAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Pos
Plasmid#61857PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, positive strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Neg
Plasmid#61856PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, negative strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo U6-SpAi9L-U6SpDMDL
Plasmid#78608PurposeExpresses gRNAs (for SpCas9) targeting 5’ of Ai9 stop cassette and Dmd intron 22DepositorInsertU6-SpAi9L-U6SpDMDL
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo U6-SpAi9R-U6-SpDMDR
Plasmid#78609PurposeExpresses gRNAs (for SpCas9) targeting 3’ of Ai9 stop cassette and Dmd intron 23DepositorInsertU6-SpAi9R-U6-SpDMDR
UseUnspecifiedPromoterU6Available SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMEL11
Plasmid#107917PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDS48
Plasmid#241839PurposeCas9-gRNA construct targeting the UBE3A locusDepositorAvailable SinceSept. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ARHGEF7/B-Pix
Plasmid#241368PurposeMammalian expression of SpCas9 and gRNA targeting ARHGEF7 (β-Pix)DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL560
Plasmid#231161PurposeT-DNA encoding TRV2 with ipt and mobile gRNA targeting SlPDSDepositorInsertipt and mobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 GFP V3
Plasmid#226961PurposeCBh-SaCas9-2A-GFP, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 puro V3
Plasmid#226960PurposeCBh-SaCas9-2A-Puro, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-E690_guide-CBh-hSpCas9
Plasmid#188545PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid E690DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-W308_guide-CBh-hSpCas9
Plasmid#188546PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid W308DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-L101_guide-CBh-hSpCas9
Plasmid#188547PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid L101DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA091
Plasmid#216106PurposeCRISPRa, gRNA expression with modified trRNA to recruit activators via PP7 tags (guide only)DepositorInsertgRNA expression with modified trRNA to recruit activators via PP7 tags
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_Tubb3 GFP(Y39TAG) KI
Plasmid#182678PurposeExpression of spCas9, gRNA targeting the end of Tubb3 gene and donor GFP(Y39TAG). Can be used for amber codon suppression and click chemistry labeling of endogenous beta-3 tubulin in mammalian cells.DepositorExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only