We narrowed to 10,272 results for: tre promoter
-
Plasmid#120470PurposeBarcoded lentiviral vector to express ONECUT1 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only
-
EF1a_MYOG_P2A_Hygro_Barcode
Plasmid#120465PurposeBarcoded lentiviral vector to express MYOG in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
Tet-FRNK-GFP
Plasmid#83472PurposeLentiviral vector for doxycycline-inducible expression of FRNK in mammalian cellsDepositorInsertFRNK (PTK2 Chicken)
UseLentiviralTagsEGFPExpressionMammalianMutationFRNK is the non-catalytic c-term domain of FAK ki…Promoterdoxycycline-inducible promoterAvailable SinceOct. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pG23A
Plasmid#102884PurposePlasmid used for the C-terminal tagging of Cdc14 with mCherry and the auxin-inducible degron in yeast.DepositorInsertCdc14/mCherry-AID(71-114)-NatMX (CDC14 Budding Yeast)
TagsAID(71-114) and mCherryExpressionYeastPromoterNative promoterAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
p-715MRPprom-MRPcucuc
Plasmid#87199PurposeExpression of ectopic mutated human MRP RNA contstruct from the human RMRP promoter, also contains CMV-puro-t2A-mCherry expression cassette for selection/transfection efficiencyDepositorAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET-30a(+)-Syk-tSH2-PM
Plasmid#111271Purposeexpress murine Syk tandem SH2 domains (Ser 8 to Gln 264), with Y130E mutation to mimic phosphorylation, in E.coli strain Rosetta 2 (DE3)DepositorInsertmurine Syk tandem SH2 domains (Ser 8 to Gln 264), with Y130E mutation to mimic phosphorylation (Syk Mouse)
ExpressionBacterialMutationY130E mutation to mimic phosphorylationPromoterT7 promoterAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-Aldh1a1-HA-WPRE-HGHpA
Plasmid#184633PurposeExpresses Aldh1a1 fused to HA, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKan-PCUP1-AID*(N)
Plasmid#99525PurposeN-terminal AID* degron cassette with CUP1 promoter and KanR marker for S. cerevisiaeDepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
cARA12-mRFP
Plasmid#181961PurposeARA12 protein tagged with mRFP, under control of TBA2 promoterDepositorAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJL3
Plasmid#184131PurposeFor rescuing null mrp-1 mutation and labelling mrp-1 protein. Intestinal specific Pges-1 promoter drives MRP-1 expression. Translational fusion construct. pPD95.75_Pges-1::mrp-1(isoform C cDNA)::gfp.DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJC20-Tpm4.2 (Rn)
Plasmid#99359PurposeBacterial expression vector containing cDNA encoding for the Rattus norvegicus tropomyosin, Tpm4.2 under the control of the pRhamnose promoterDepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRS426-TUB1-internal6xHis (1-440)
Plasmid#60391PurposeExpression of yeast alpha tubulin (TUB1) - internal 6xHis without Cterminal tail using a GAL promoterDepositorInsertTUB1 (TUB1 Budding Yeast)
ExpressionYeastMutationinternal 6xHis (see supplement figure 4), amino a…PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
RCAN1-aa1-150
Plasmid#65412PurposeRCAN1 aa1-150 expression with CMV promoter. Flag tagged.DepositorInsertRCAN1-aa1-150 (Rcan1 Mouse)
TagsFlagExpressionMammalianMutationaa1-150 present, deleted 151 to endAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235297PurposeComMAND open-loop circuit regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235298PurposeComMAND closed-loop circuit regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mRuby2-bGH
Plasmid#235296PurposeComMAND base gene regulating mRuby2, CAG-drivenDepositorInsertmRuby2
UseSynthetic BiologyExpressionMammalianPromoterCAG (synthetic cytomegalovirus early enhancer + c…Available SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2(intΔNACs&ΔMYBs):GFP
Plasmid#218572PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantMutationMutation genomic sequence 85nt, 86nt from TA to C…Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFsynW SYT1-PGM reporter
Plasmid#197278PurposeEncodes for viral expression of Synaptotagmin 1 (SYT1) for use in the RUSH system; visualized with HaloTag. Reporter only (no hook). SYT1 is mutated to disrupt palmitoylation and glycosylation.DepositorInsertSYT1 and HaloTag (Syt1 Rat)
UseLentiviralTagsFLAGMutationT15A, T16A, N24Q, C74A, C75A, C77A, C79A, and C82APromoterhSyn (human synapsin I promoter)Available SinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only