We narrowed to 13,668 results for: ache
-
Plasmid#218880PurposeAAV-mediated expression of improved GABA sensor (positive change in fluorescence)DepositorInsertiGABASnFR2
UseAAV and Cre/LoxExpressionMammalianMutationS99A F102Y F104Y L178SPromoterCAGAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-PAX3-FOXO1/FKHR
Plasmid#115526PurposeMammalian expression constructDepositorAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#2/Cre
Plasmid#193245PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
shBIRC5 # 2
Plasmid#42554DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
shBIRC5 # 1
Plasmid#42553DepositorAvailable SinceFeb. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS106a
Plasmid#87382PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1a-EGFP-ERGIC53-IRES-Puromycin
Plasmid#134859PurposeExpresses EGFP-tagged ERGIC markerDepositorAvailable SinceMarch 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNK5712
Plasmid#219752PurposepGAP-like vector encoding mutant of Neonothopanus nambi hispidin-3-hydroxylase nnH3H_v2 under control of GAP promoter, for yeast expressionDepositorInsertpGAP - nnH3H_v2 - tAOX
ExpressionYeastAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B Q78L
Plasmid#89448PurposeExpression of GFP-tagged human Rab27B Q78L in mammalian cellsDepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNK5867
Plasmid#219751PurposepGAP-like vector encoding hispidin-synthase from Mycena citricolor under control of GAP promoter, for yeast expressionDepositorInsertpGAP - mcitHispS - tAOX
ExpressionYeastAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK1508
Plasmid#219750PurposepGAP-like vector encoding Aspergillus nidulans 4'-phosphopantetheinyl transferase NpgA under control of GAP promoter, for yeast expressionDepositorInsertpGAP - npgA - tAOX
ExpressionYeastAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE3_ mTFP1- Vamp2
Plasmid#201214PurposeAAV expression of TRE(TRE3G)-driven, Vamp2-conjugated mTFP1 expression for fluorescent labling of axon terminalsDepositorInsertmTFP1 (from addgene #54613)
UseAAVTagsmouse Vamp2ExpressionBacterial and MammalianPromoterTRE3GAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2 LRP6-eGFP
Plasmid#180143Purposeto make movies of LRP6 vesiclesDepositorAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUW-tetO-GATA2
Plasmid#125028Purposedoxycycline-inducible expression of human GATA2 in mammalian cellsDepositorInsertGATA binding protein 2 (GATA2 Human)
UseLentiviralTagsNoneExpressionMammalianPromoterTRE-mCMVAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pELPS-eDHFR-YFP-T2A-Renilla
Plasmid#193253PurposeTriple reporter plasmid in pELPS with eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferaseDepositorInsertThe eDHFR (PET reporter gene) fused to yellow fluorescent protein (YFP) and a T2A cleavage site followed by Renilla luciferase
UseLentiviralTagsRenilla luciferase (rLuc) and yellow fluorescent …MutationNonePromoterEF1aAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF1a-ZIM3-Cas9-P2A-GFP-PGK-Blasti
Plasmid#239610PurposeConstitutive active CRISPRgenee construct with a blasticidin resistanceDepositorInsertZIM3 KRAB domain (ZIM3 )
UseCRISPR and LentiviralAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-HA-GFI1B
Plasmid#125599Purposedoxycycline-inducible expression of human GFI1B (HA tagged) in mammalian cellsDepositorInsertGrowth Factor Independent 1B transcriptional repressor (GFI1B Human)
UseLentiviralTagsHA tagExpressionMammalianPromoterTRE-mCMVAvailable SinceJune 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ 2xFLAG-2xSTREP_FBXO22
Plasmid#159127Purposeexpresses FBXO22 in mammalian cellsDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETDuet1_6xHis-TEV-EGFP-FIP200-CTR(1429-1591aa)
Plasmid#223724PurposeExpression of recombinant protein for purificationDepositorInsertFIP200-CTR (RB1CC1 Human)
Tags6xHis-TEV-EGFPExpressionBacterialMutationaa 1429-1591 onlyAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only