We narrowed to 10,560 results for: fus
-
Plasmid#69020PurposeExpresses rat Cx43 (Gja1 CDS) with an 8 amino acid linker on the N-terminus of the Connexin linking to Enhanced Blue Fluorescent Protein 2 (FP fused to NT of connexin). CMV promoter.DepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only
-
LV-TRE-VP16 mouse MyoD-T2A-dsRedExpress2
Plasmid#60626PurposeExpresses VP16 mouse MyoD and dsRedExpress2 in response to doxycyclineDepositorInsertVP16 mouse MyoD
UseLentiviralPromoterTREAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
ptdTHC
Plasmid#112617Purposepromoterless expression plasmid driving multicistronic cassette H2BtdTomato_p2A_HygroR_p2A_CreERt2DepositorInsertsUsePromoterless vector, ready for promoter for mamma…TagstdTomatoExpressionMammalianPromoterNo PromoterAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
cBEST4
Plasmid#234660PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3 and tcp830Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-29b(+)_NSP4ss_SerM_NucA-myc
Plasmid#218191PurposeBacterial expression of a periplasmically expressed myc-tagged Serratia Marcescens NucA (Benzonase)DepositorInsertnucA
Tags2xmyc and NSP4 signal secretion peptideExpressionBacterialMutationcodon optimized for E. coli, residues 22-266PromoterT7Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKM427
Plasmid#210788PurposeL5 integrating vector for delivery of defective Hyg gene (ZeoR) for oligonucleotide-mediated SNP transferDepositorInsertDefective hygromycin resistant gene
ExpressionBacterialMutationChanged hygromycin resistant gene W190 codon (TGG…Available SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP SMG1 WT
Plasmid#199571PurposeExpresses WT SMG1 fused to GFPDepositorAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFX-mito-roGFP
Plasmid#174181PurposeExpress roGFP with mitochondria-targeting sequence in mammalian cellsDepositorInsertroGFP with mitchondria-targeting sequence
Tagsthe mitochondria-targeting sequence of the cytoch…ExpressionMammalianPromoterCMVAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pONSY-CoNMM:mCherry
Plasmid#111878PurposeThis plasmid expresses mCherry fluorescent protein fused to an N-Myristoylation motif (NMM) from the endogenous Src2 gene (CAOG_06360). It can be used to visualize the membrane and filopodia.DepositorInsertCapsaspora N-Myristoylation motif (CoNMM) from the Src2 gene fused to mCherry
UseCapsaspora owczarzakiTagsmCherryPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC101
Plasmid#62335PurposesgRNA (no RNA aptamer addition) with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR P2R-P3-ECFP
Plasmid#48353PurposeContributes the coding sequence for ECFP as the 3’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertECFP
UseGateway CloningMutationContains a stop codon.PromoternoneAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCru5-/CGA-mEGFP-IRES-mCherry
Plasmid#49224PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
TS-PE2-C-WPRE
Plasmid#176650PurposeExpresses C-terminus of PE2 in mammalian cellsDepositorInsertsC-terminus of PE2
Artificial SA
WPRE
bGH poly(A)
UseAAVTagsSV40 NLSExpressionMammalianPromoterNoneAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXN1
Plasmid#101445PurposeDonor Vector containing FOXN1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXN1 (FOXN1 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-B4E
Plasmid#162067PurposeFor expresion of the B4E fusion protein, consists of the ampR gene (encoding the enzyme β-lactamase without the native signal sequence) fused to residues 28-215 of the murine eIF4EDepositorInsertampR-eIF4E fusion protein
Tags6xHis tagExpressionBacterialMutationeIF4E incorporating the K119A mutation, which is …PromoterT7Available SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-FlpERT2
Plasmid#149438PurposeROSA26 mouse targeting vector with tamoxifen-inducible Flp recombinaseDepositorInsertFlp-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Myc:P4:gs:nls:ABI
Plasmid#135985PurposeExpresses the P4 coiled coil fused to the ABI abscisic acid-inducible domain in mammalian cellsDepositorInsertP4 coiled-coil fused to the ABI domain
TagsMycExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS-CG-Lock-Cer-VWF
Plasmid#124828PurposeExpresses multimeric human VWF-ECFP fusion protein with A2-Lock domain The cyan fluorescence protein coding region is inserted between the VWF-D'D3 and A1 domains.DepositorInsertVWF with cyan fluorescent protein fusion between D'D3 and A1 domains and Lock A2 domain (VWF Human)
ExpressionMammalianPromoterCMVAvailable SinceMay 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
VC388
Plasmid#49958PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceDec. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-Flag-mIL-17RA/YFP.Hygro
Plasmid#46862Purposeencodes Flag-tagged mouse IL-17RA fused to Yellow Fl. ProteinDepositorInsertIL-17RA-YFP
TagsFlag/IL-3 signal sequence and fused to CFPExpressionMammalianPromoterCMVAvailable SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only