We narrowed to 3,337 results for: GCT
-
Plasmid#211995PurposeExpress gRNA against ZIC2 with puro and BFPDepositorInsertsgRNA targeting ZIC2 (ZIC2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3R/MPL-shRNA3
Plasmid#204528PurposeLentiviral expression of MPL-shRNA3; gene knock down of human MPLDepositorInsertMPL-shRNA3 (MPL Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA9
Plasmid#196108PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196103, 196106, 196107DepositorInsertSAFB (Safb Mouse)
UseCRISPR and Mouse TargetingTagsExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSphkap#2/Cre
Plasmid#193241PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sphkap geneDepositorInsertsgSphkap#2 (Sphkap Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-DSP
Plasmid#185549PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting DSPDepositorInsertDSP gRNAs
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon5
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZmat3.52.6/Cre
Plasmid#167854PurposeExpresses Cre recombinase and an sgRNA targeting Zmat3DepositorInsertsgRNA targeting Zmat3
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingTagsExpressionMammalianMutationPromoterAvailable sinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 E1754K
Plasmid#139330PurposePlasmid expressing a sgRNA to introduce BRCA1 E1754K using base editingDepositorInsertsgRNA to insert BRCA1 E1754K using base editing
UseTagsExpressionMammalianMutationPromoterU6Available sinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PGK2 gRNA (BRDN0001149179)
Plasmid#76947Purpose3rd generation lentiviral gRNA plasmid targeting human PGK2DepositorUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIB1 gRNA (BRDN0001162480)
Plasmid#76662Purpose3rd generation lentiviral gRNA plasmid targeting human TRIB1DepositorInsertTRIB1 (TRIB1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME4 gRNA (BRDN0001145289)
Plasmid#76172Purpose3rd generation lentiviral gRNA plasmid targeting human NME4DepositorInsertNME4 (NME4 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
C8orf44-SGK3 gRNA (BRDN0001146567)
Plasmid#75906Purpose3rd generation lentiviral gRNA plasmid targeting human C8orf44-SGK3DepositorInsertC8orf44-SGK3,SGK3 (SGK3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgEIF3D-4
Plasmid#236766PurposeA piggybac-based vector containing mouse U6 promoter-driven EIF3D sgRNA #4 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertEIF3D sgRNA-4 (EIF3D Human)
UsePiggybacTagsExpressionMammalianMutationPromotermouse U6 promoter and mouse U6 promoter, CAG prom…Available sinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 sequence: GTCGCTACCTACAGCCAGGA, Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationTagsExpressionMammalianMutationPromoterhU6 and mU6Available sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (GAPDH)
Plasmid#170120PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNADepositorInsertCircular 200,100 guide RNA (GAPDH Human)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only