We narrowed to 27,803 results for: gfp
-
Plasmid#127527PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase phiC31 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase phiC31 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)Bxb1
Plasmid#127528PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase Bxb1 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase Bxb1 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-39:RAB5A-mEGFP
Plasmid#107579PurposeHomology arms and mEGFP-linker sequence for N-terminus tagging of human RAB5ADepositorInsertRAB5A Homology Arms with mEGFP-linker (RAB5A Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMay 9, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
ZJOM10
Plasmid#133639PurposeIntegration of VPS4-GFP as an additional copy in genome, use auxotrophic marker URA3(Candida albicans). Marker for yeast late endosome.DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
CD4-C-GFP HDRT Source (pTR 152)
Plasmid#112018PurposeDNA sequence source for amplifying an HDR template to tag endogenous human CD4 gene with GFPDepositorInsertCD4-GFP HDRT (CD4 Human)
UseCRISPR and Synthetic BiologyAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSJ1256 (pFA6-link-yGFP1-10-CaURA3MX)
Plasmid#86419PurposeC-terminal PCR tagging module for yeast codon optimized split GFP1-10DepositorInsertGFP1-10
ExpressionYeastAvailable SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGRE NPD-GFP
Plasmid#1197DepositorInsertN-terminus of Sup35 fused to GFP (SUP35 Budding Yeast)
TagsGFPExpressionYeastMutationfused N-terminal Sup35 (~1-253aa) to GFPAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pKT0220
Plasmid#8736DepositorInsertyECitrine
Tags3x HA and Codon optimized linkerExpressionYeastMutationyEGFP with S65G, V68L, Q69M, S72A, T203YAvailable SinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP34
Plasmid#247209PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from a T7 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterT7Available SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6-LSL (Cre dependent)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQE-60 roGFP2-Orp1-His
Plasmid#64976PurposeBacterial expression of His-tagged roGFP2-Orp1DepositorAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yoGFPgamma-SpHis5
Plasmid#44859PurposeYeast tagging vector to create gene fusion with yeast optimized GFPgamma with SpHis5 selectionDepositorInsertyoGFPgamma
ExpressionYeastAvailable SinceMay 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
MSCV-CMV-DsRed-IRES-d4EGFP
Plasmid#41943PurposeRetroviral expression of DsRed in mammalian cellsDepositorInsertDsRed
UseRetroviralExpressionMammalianPromoterTREAvailable SinceJuly 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJS145
Plasmid#179159PurposeEncodes 2xNLS::GFP(flexon), codon optimized for C. elegans. Blocks expression from ubiquitous promoter rps-27p with Flexon. Excision of flexon with Cre allows for strong expression.DepositorInsertrps-27p::2xNLS::GFP(flexon)::unc-54 3' UTR
ExpressionWormMutationFlexon replacing 2nd intron of 2xNLS::GFPPromoterrps-27pAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLacI-GFP-HEC1 WT
Plasmid#114049PurposeExpression of exogenous LacI-GFP-HEC1 WTDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRC55-GFP-DHX37
Plasmid#192150Purposeexpress GFP-DHX37DepositorAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
YW249_Pzipt17-loxP-H2BGFP-miniMOS
Plasmid#196063Purposea plasmid modified from miniMOS vector pCFJ910. the modification including insertions of SL2::H2B::GFP downstream to NeoR CDS and 2 loxP sites flanking the NeoR and GFP cassettes.DepositorInsertsH2B::GFP
NeoR
Minimal Mos1
zipt17p::zipt17::zipt17 3UTR
ExpressionWormAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-APP-mGFP
Plasmid#196704PurposeExpresses APP695 with two fluorescent proteins at the ends to follow processing in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsmCherry and mEGFPExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only