We narrowed to 14,263 results for: crispr grnas
-
Plasmid#179332PurposeNT-CRISPR plasmid for a single gRNA.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_119_LVL2 cam
Plasmid#179333PurposeNT-CRISPR plasmid for integration of multiple gRNAs.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, sfGFP dropout to be replaced with gRNAs
UseCRISPRAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCB320
Plasmid#89359Purpose3rd generation lentiviral sgRNA expression vector with mCherry, puromycin resistance, BlpI+BstXI cloning sitesDepositorInsertpuromycin resistance, mCherry
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
p201B Cas9
Plasmid#59177PurposeCas9 driven by double 35S, BAR for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
BAR
UseCRISPRPromoter2x35SAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
p201G Cas9
Plasmid#59178PurposeCas9 driven by double 35S, GFP for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
sGFP
UseCRISPRPromoter2x35SAvailable SinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pV1200
Plasmid#111429PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - integrates at ENO1 - Recyclable for serial mutagenesis (Sap2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAEF5
Plasmid#136305PurposePlasmid encoding the Cas9 gene and a gRNA expression cassette allowing to clone a single or multiple gRNAs for DSBs induction in yeast. Constructed by Aubin FleissDepositorTypeEmpty backboneUseCRISPRAvailable SinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJA55
Plasmid#59935PurposegRNA for cleavage near sqt-1(e1350) locus in C elegansDepositorInsertsqt-1(e1350) gRNA2
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLdSaCN
Plasmid#123261PurposeExpresses Staphylococcus aureus Cas9 (SaCas9) and its gRNA in LeishmaniaDepositorInsertgRNA and SaCas9
UseCRISPR; LeishmaniaAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-COSMC-KO
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorInsertCOSMC (C1GALT1C1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-MGAT1-KO
Plasmid#80009PurposegRNA to knock out expression of MGAT1 gene. The product of this gene is essential for synthesis of complex and hybrid N-Glycans.DepositorInsertMGAT1 (MGAT1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMEL13
Plasmid#107919Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL12
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTargetF-FRT
Plasmid#113637PurposeDerivative of pTargetF with gRNA targeting FRT siteDepositorInsertsgRNA-FRT
UseCRISPRPromoterpJ23119Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL10
Plasmid#107916PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL17
Plasmid#107923PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL14
Plasmid#107920PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only