We narrowed to 14,052 results for: crispr grnas
-
Plasmid#175873PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertHEY2-Nickase1
UseCRISPRAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
HEY2.1.2-gDNA
Plasmid#175874PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertHEY2-Nickase2
UseCRISPRAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
OVOL2.2.1-gDNA
Plasmid#175876PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertOVOL2-Nickase1
UseCRISPRAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
OVOL2.2.2-gDNA
Plasmid#175877PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertOVOL2-Nicakse2
UseCRISPRAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPHB.1.0-gDNA
Plasmid#132453PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertPHB
UseCRISPRAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPfetFn-Target_v2
Plasmid#199564PurposegRNA expression for FnCas12a in E. coli and clostridiaDepositorInsertSacB
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPthl_fUAvailable SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
vHB8
Plasmid#193454PurposeExpression of GFP-Cas9-NLS and gRNA in A. castellaniiDepositorInsertGFP-Cas9-NLS
UseCRISPRTagsGFPPromoterGAPDHAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pADH110
Plasmid#90982PurposeNAT-marked pSNR52 promoter fragment for use in gRNA expression cassette stitching PCR; for use with pADH119, 139, or 147 to generate target-specific gRNA expression cassette.DepositorInsertsNAT 2 of 2
pSNR52
UseCRISPRAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMH183
Plasmid#122856PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate D-E flanking sequencesDepositorInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMH184
Plasmid#122857PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate E-F flanking sequencesDepositorInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT/Cre
Plasmid#66895PurposeExpresses a non-targeting gRNA and Cre-recombinaseDepositorInsertsgNT
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNeo/Cre
Plasmid#67594PurposeExpresses an Neomycin-targeting gRNA and Cre-recombinaseDepositorInsertsgNeo
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgLkb1/Cre
Plasmid#66894PurposeExpresses an Lkb1-targeting gRNA and Cre-recombinaseDepositorInsertsgLkb1
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v4)-PGK-Puro-BFP
Plasmid#117143PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v4 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v5)-PGK-Puro-BFP
Plasmid#117144PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v5 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pST_140_LVL2 cam
Plasmid#179334PurposeNT-CRISPR plasmid for a single gRNA with spG Cas9 (near PAM-less Cas9 variant).DepositorInsertPtac tfoX, Ptet spG cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRMutationCas9 -> SpG Cas9 (D1135L, S1136W, G1218K, E121…Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only