Showing: 61 - 80 of 96 results
-
Plasmid#167886PurposePiggyBac compatible plasmid expressing dCas9-VPRDepositorInsertdCas9-VPR
UseCRISPRTagsExpressionMutationD10A, D839A, H840A, N863APromoterAvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_VPR_Puro
Plasmid#167887PurposePiggyBac compatible plasmid expressing dCas9-VPRDepositorInsertdCas9-VPR
UseCRISPRTagsExpressionMutationD10A, D839A, H840A, N863APromoterAvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_VPR_KanR neo
Plasmid#167885PurposePiggyBac compatible plasmid expressing dCas9-VPRDepositorInsertdCas9-VPR
UseCRISPRTagsExpressionMutationD10A, D839A, H840A, N863APromoterAvailabilityAcademic Institutions and Nonprofits only -
KL001: pMAGIC (R4-R3) NLS-(SrfI/PmeI)-NLS-VPR
Plasmid#121836PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS/VPR scaffold enabling addition of dCas9 mutants into pMAGIC. dCas9 can be inserted via unique SrfI/PmeI restriction sitesDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidTagsExpressionMutationPromoterAvailabilityAcademic Institutions and Nonprofits only -
M_ST1n_VPR
Plasmid#63799PurposeST1-dCas9 with VP64-p65-Rta (VPR) fused to it's C-terminus; mammalian vectorDepositorInsertST1-dCas9-VPR
UseCRISPR and Synthetic BiologyTagsVPR (VP64-p65-Rta)ExpressionMammalianMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pAAV-dSa-VPR
Plasmid#99651PurposeExpresses tripartite VP64-p65-RTA activator fused to C term. of dead Sa Cas9DepositorInsertdCas9
UseAAVTagsVP64-p65-RTA activatorExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pSLQ2804 pHR: U6-SpsgTRE3G CMV-PYL1-VPR-IRES-mCherry
Plasmid#84258PurposeExpresses Sp sgTRE3G gRNA with ABA-inducible VPR and mCherry for OR gateDepositorInsertsSp sgTRE3G
PYL1-VPR
UseCRISPR and LentiviralTagsIRES-mCherry and PYL1ExpressionMammalianMutationPromoterCMV and mouse U6AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa-VPR mini.
Plasmid#99685PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoterDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-dSa-VPR mini.
Plasmid#99686PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from EFS promoterDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-1X snRP1
Plasmid#99687PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with 17 nt snRP1 poly adenylation signalDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-2X snRP1
Plasmid#99688PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with 34 nt dual snRP1 poly adenylation signalDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-syn pA
Plasmid#99689PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with syn pA (poly adenylation) signalDepositorArticleInsertdCas9
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
dCas9v2
Plasmid#103140PurposeTetR inducible dCas9-VPR plasmid with pRPR-NotI-tRPR1 Csy4-ready siteDepositorInsertdCas9-VPR
UseTagsExpressionYeastMutationRemoved scaffold gRNA from original plasmidPromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (Hbb Synthetic)
UseAAVTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pCRI006-pYFAC-riboB-PgpdA-dSpCas9-VPR-TtrpC
Plasmid#140199PurposeEpisomal expression of dSpCas9-VPR. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdSpCas9-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSExpressionMutationPromoterPgpdAAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailabilityAcademic Institutions and Nonprofits only -
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
Plasmid#140196PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.DepositorInsertsdSpCas9-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta) , NLSExpressionMutationPromoterPgpdA and PtrpCAvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgMyo7b-CMV-5’dCas9-SDS-BD10-SV40pA
Plasmid#216322PurposeTransactivation of murine Myo7b gene via split dCas9-VPR (REVeRT system).DepositorInsertSplit Cas9-VPR + splice donor site + gRNAs targeting the murine Myo7b locus for transactivation
UseAAVTagsExpressionMutationPromoterCMVAvailabilityAcademic Institutions and Nonprofits only
Showing: 61 - 80 of 96 results