We narrowed to 15,648 results for: grn
-
Plasmid#91881PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting Suz12 (Suz12 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 RFP670
Plasmid#187646Purposelentiviral vector expressing RFP670 alongside Cas9 and an sgRNA cloning siteDepositorInsertRFP 670
UseLentiviralTagsRFP670 and sgRNA cloning sitePromoterEFS (P2A)Available sinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PSUPER-1660(hPot1)
Plasmid#11131DepositorInsertRNAi against human Protection of Telomeres 1 (POT1 Human)
UseRNAiExpressionMammalianMutationN/AAvailable sinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Rims2-GFP KI
Plasmid#131495PurposeEndogenous tagging of RIM2: C-terminal (amino acid position: S1551)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAExpressionMammalianPromoterU6 and CbhAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpG-PPE
Plasmid#170130PurposeFor plant prime editing in wheat plants or monocotyledons protoplastsDepositorInsertnCas9-SpG(H840A)-M-MLV
UseCRISPRExpressionPlantMutationH840A, D1135L, S1136W, G1218K, E1219Q, R1335Q, T1…Promotermaize Ubiquitin-1Available sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-sh-mFAK C
Plasmid#37015DepositorAvailable sinceMay 31, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDB4283
Plasmid#98702PurposeA plasmid containing the 3' portion of the bsdMX marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-bsdMX systemDepositorInsertgRNA PCR template
UseCRISPRExpressionYeastAvailable sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2301
Plasmid#91067PurposeModule B, Promoter: 35S, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with tRNA spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with tRNA spacers
UseCRISPRPromoter35SAvailable sinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Ftz-M3
Plasmid#11245DepositorInsertFtz-M3
Tags3 MS2 hairpinsExpressionBacterialAvailable sinceJan. 19, 2006AvailabilityAcademic Institutions and Nonprofits only -
PSUPER-1660s(hPot1)
Plasmid#11132DepositorInsertRNAi vector for human protection of telomeres 1(control for 1660) (POT1 Human)
UseRNAiExpressionMammalianMutationN/AAvailable sinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
PSUPER-344s(hPot1)
Plasmid#11134DepositorInsertRNAi vector for human protection of telomeres 1(control for 344) (POT1 Human)
UseRNAiExpressionMammalianMutationN/AAvailable sinceMarch 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJPC596 FoMV-AmCyan
Plasmid#234812PurposeTo express flourescent protein AmCyan from the Foxtail Mosaic Virus Vector (T-DNA)DepositorInsertAmCyan
ExpressionPlantAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgNT
Plasmid#138681PurposeExpresses a non-targeting sgRNA and Cas9DepositorInsertsgNT
UseLentiviralPromoterhU6Available sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Mef2D-shRNA
Plasmid#32900DepositorAvailable sinceNov. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
PMXS-GOT1
Plasmid#72872PurposeThe retroviral GOT1 vector was generated by cloning an sgRNA resistant human GOT1 gene block into the pMXS-ires-blast vector by Gibson Assembly.DepositorInsertGOT1 (GOT1 Human)
UseRetroviralExpressionMammalianMutationsgRNA resistant human GOT1, 7 silent mutations c1…Available sinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pG4
Plasmid#162605PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable sinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUPERretro-Sirt6 shRNA1
Plasmid#53147PurposeshRNAi vector for Sirt6DepositorInsertSirt6
UseRNAi and RetroviralExpressionMammalianPromoterH1 RNA polymerase IIIAvailable sinceMay 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
PX458_ATF1_1
Plasmid#64690PurposeExpresses gRNA against human ATF1 along with Cas9 with 2A GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA
UseCRISPRAvailable sinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRSITEP-puro-shWRN1
Plasmid#125783PurposeDOX-inducible expression of a short-hairpin RNA targeting human WRNDepositorInsertshWRN1 (WRN Human)
UseRNAiAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by