We narrowed to 10,607 results for: ada
-
Plasmid#231713PurposeCRISPR mediated KI of BromoTag at N-terminus of BRD2-GFP-P2A-BromoTag, works well with KHC064 and KHC065DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only
-
8027_GFP-KrasG12C_2B_puro
Plasmid#64372PurposeThis a retroviral expression plasmid expressing GFP tagged G12C mutant Kras 2B oncogene along with puro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9-P2A-EGFP (BKS327)
Plasmid#223123PurposepCMV and pT7 Human expression plasmid for TadCBEd-SpCas9 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadCBEd-SpCas9-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9=D10APromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic_ME.1/ApoEpromoter
Plasmid#51435PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancerDepositorUseLuciferaseExpressionMammalianMutationME.1 enhancer is fused upstream of ApoE promoter …Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPB-AMBRA1-3xFLAG
Plasmid#174159PurposePiggyBac vector to stably express 3xFLAG-tagged AMBRA1DepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-tdTHC
Plasmid#112621Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BtdTomato_p2A_HygroR_p2A_CreERt2DepositorInsertsUseCre/LoxTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCG_SARS-CoV1 N C-V5-tag
Plasmid#179968PurposeMammalian expression vector for SARS-CoV-1 N, V5-tagged. Sequence codon-optimized.DepositorAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCG_SARS-CoV1 NSP3 C-V5-tag
Plasmid#179962PurposeMammalian expression vector for SARS-CoV-1 Nsp3, V5-tagged. Sequence codon-optimized.DepositorAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
8798 GFP-KrasG12C_2B_hygro
Plasmid#64376PurposeThis a retroviral expression plasmid expressing GFP tagged G12C mutant Kras 2B oncogene along with hygro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCG_batCoV RaTG13 ORF3a C-V5-tag
Plasmid#179988PurposeMammalian expression vector for RaTG13 ORF3a, V5-tagged. Sequence codon-optimized.DepositorInsertRaTG13 ORF3a
ExpressionMammalianMutationhuman codon-optimizedAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
ptdTHC_PGKneoLox2DTA.2
Plasmid#112625PurposeH2BtdTomato_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagstdTomatoPromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCG_SARS-CoV2 NSP15 C-V5-tag
Plasmid#179975PurposeMammalian expression vector for SARS-CoV-2 Nsp15, V5-tagged. Sequence codon-optimized.DepositorAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
BCL6-GFP G55A in Artichoke
Plasmid#169935PurposeOverexpression of BCL6-GFP G55A mutant fusionDepositorAvailable SinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 Delta F-Box
Plasmid#197452PurposeThe plasmid expresses F-box deleted version of Myc-tagged FBW7 human isoform 1. Used for mammalian overexpression of FBW7alpha delta-F-Box and detection by western blotting.DepositorAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-sfCherry2_SEPT6
Plasmid#180313Purposebacterial co-expression of human SEPT2 fused to superfolder Cherry2 and of human SEPT6DepositorTagsHis6-TEV and sfCherry2ExpressionBacterialAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-hCCND1-T286A-HA
Plasmid#174155PurposeLentiviral vector expressing HA-tagged human cyclin D1 with T286A mutationDepositorInsertCCND1 (CCND1 Human)
UseLentiviralTagshemagglutinin (HA)ExpressionMammalianMutationA>G at base 856 (Thr>Ala at amino acid 286)PromoterEF1AAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-V5-SHLD3
Plasmid#114124PurposeExpresses N-terminally tagged V5-SHLD3 in mammalian cellsDepositorInsertSHLD3 (SHLD3 Human)
UseGenomic integration, tetracycline inducibleTagsV5ExpressionMammalianPromoterCMV/TetO2Available SinceAug. 23, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
8047_GFP-Kras2B_ires_puro
Plasmid#64371PurposeThis a retroviral expression plasmid expressing GFP tagged wild type Kras 2B oncogene along with puro resistance geneDepositorAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
DHC1-AID-Clover donor (Neo)
Plasmid#158621PurposeDonor plasmid for tagging DHC1 with AID-CloverDepositorInsertDHC1 (DYNC1H1 Human)
UseCRISPR; Tagging donorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only