We narrowed to 12,891 results for: Uty
-
Plasmid#158790PurposepcDNA5 based transfection plasmid for the exogenous expression of N-terminal BirA-Flag-tagged eIF4G1 including the microexon for generation of N2A FlpIn cell lines for BioIDDepositorInserteIF4G1 (with microexon)
Tags3xFlag and BirA*ExpressionMammalianPromoterminiCMVAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS1132
Plasmid#29053PurposeHigh copy homologous recombination plasmid for gene targeting at the mouse Hprt locus containing Ple67 (FEV MiniPromoter) driving an EGFP/Cre fusion reporterDepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
EC1000
Bacterial Strain#71852PurposeRepA+ MC1000, KmR , carrying a single copy of the pWV01 repA gene in the glgB gene; host for pOR128-based plasmidsDepositorBacterial ResistanceKanamycinAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-NRASG12V/D38A-IRES-mVenus
Plasmid#236077PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and a double mutant NRAS (NRASG12VD38A).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12V D38APromoterCAGGSAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-NRASG12V-IRES-mVenus
Plasmid#236076PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterCAGGSAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/CAGGS-mVenus-P2A-NRASG12V
Plasmid#236072PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Caggs promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterCAGGSAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-E166D
Plasmid#226720PurposeMammalian expression of cytosolic mouse CNDP2 mutant E166DDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-E166L
Plasmid#226721PurposeMammalian expression of cytosolic mouse CNDP2 mutant E166LDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-D195A
Plasmid#226722PurposeMammalian expression of cytosolic mouse CNDP2 mutant D195ADepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-CNDP2-H445F
Plasmid#226723PurposeMammalian expression of cytosolic mouse CNDP2 mutant H445FDepositorAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/UBC-mVenus-P2A-NRASG12V
Plasmid#236074PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Ubc promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterUbcAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT/PGK-mVenus-P2A-NRASG12V
Plasmid#236073PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Pgk promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterPGKAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTargetF
Plasmid#62226PurposeConstitutive expression of sgRNA without donor editing template DNADepositorInsertsgRNA
UseCRISPRExpressionBacterialPromoterpij23119Available SinceMarch 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR_Gal4UAS_tBFP_PGK_mCherry
Plasmid#79130PurposeLentiviral vector - tBFP reporter for Gal4DBDVP64 synNotch receptors with a constitutive mCherryDepositorInserttBFP
UseLentiviralAvailable SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDiGc
Plasmid#59322PurposeInducible expression of dsRed and constitutive expression of GFP in bacteriaDepositorInsertsEGFP
dsRed
ExpressionBacterialPromoterPbad and rpsMAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-hCHD7
Plasmid#89458Purposeconstitutive expression of human CHD7 in mammalian cellsDepositorAvailable SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJYS2.1-crtYf
Plasmid#89077PurposeConstitutive transcription of crRNA of crtYF. CRISPR of C. glutamicum.DepositorInsertcrRNA of crtYF
UseCRISPRExpressionBacterialAvailable SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKD236-4b
Plasmid#90956PurposeExpresses ThsS constitutivelyDepositorInsertThsS
ExpressionBacterialPromoterBba_J23104Available SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only