We narrowed to 4,733 results for: GCA
-
Viral Prep#162380-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE (#162380). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE plasmid DNA. CAG-driven, Cre-dependent expression of calcium sensor GCaMP8s (more sensitive). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-hSynapsin1-axon-jGCaMP8m-P2A-mRuby3 (AAV9)
Viral Prep#172922-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSynapsin1-axon-jGCaMP8m-P2A-mRuby3 (#172922). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-axon-jGCaMP8m-P2A-mRuby3 plasmid DNA. hSyn-driven expression of jGCaMP8m in axons with cytosolic expression of mRuby3. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Salsa6f
Plasmid#140188PurposeSalsa6f is a fluorescent ratiometric genetically encoded calcium indicator, (tdTomato linked to GCaMP6f by a V5 epitope tag)DepositorInsertSalsa6f
TagstdTomato-v5-GCaMP6fExpressionMammalianPromoterCMV Immediate EarlyAvailable SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
Plasmids for Multiplexed Optical Sensors Arrayed in Islands of Cells (MOSAIC)
Plasmid Kit#1000000175PurposePlasmids and Gateway entry vectors for fluorescent sensors of diverse physiological parameters in cells.DepositorApplicationGene Expression and LabelingVector TypeLentiviral, Mammalian ExpressionAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shBRCA1 #2
Plasmid#44595DepositorAvailable SinceMay 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
ePPE-spG
Plasmid#183096PurposeFor plant prime editing in rice plants or monocotyledons protoplastsDepositorInsertNls-nspGCas9-NC-nls-MLV-Nls
UseCRISPRExpressionPlantMutationD10A in SpGCas9Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-dCas9
Plasmid#125687PurposeGene knockdown for actinomycetesDepositorInsertstreptomyces codon optimized spdCas9, sgRNA casette
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pnsgRNA
Plasmid#172717PurposeDelivery of guide RNA for prime editingDepositorInsertJ23119-gRNA
ExpressionBacterialAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cas9-ScaligD
Plasmid#125688PurposeGene knockout/in for actinomycetesDepositorInsertstreptomyces codon optimized spCas9, sgRNA casette, and ScaligD
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable SinceNov. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai38
Plasmid#34883DepositorInsertCAG-Floxed GCaMP3
UseMouse TargetingPromoterCAGAvailable SinceMarch 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
QPM-sgR (pTaU3)
Plasmid#140448PurposeFor sgRNA expression in monocotyledons protoplastsDepositorInsertTaU3-sgRNA
UseCRISPRExpressionPlantPromoterTaU3Available SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-SCR-sgRNA-A
Plasmid#177811PurposeOverexpression of sgRNAs in E. coli HT115 (scrambled targeting sequences)DepositorInsertScrambled sgRNA targeting sequences
ExpressionBacterialAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUCsRNAP
Plasmid#182746PurposeSwapping in small RNA promoter, 23-bp spacer sequence, & 19-bp repeats into pJC005 plasmidsDepositorInsertsmall RNA promoter, a 23-bp spacer sequence, & 19-bp repeats
UseCRISPRAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
MK1283
Plasmid#71428PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 1535 and a TetR translation rate of 30709DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS: AACCGAGCCCAATATAGGACCTAGGGTGCCAAAAAA and …Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorInsertSgRNA
UseCRISPRAvailable SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
Plasmid#140082PurposeEntry cloning vector for in vitro transcription or expression of SpCas9 sgRNAs from a T7 promoterDepositorInsertpT7-[BsaI_cassette]-SpCas9_sgRNA_scaffold (MSP3485)
UseIn vitro transcription (mrna synthesis)ExpressionBacterialPromoterT7Available SinceOct. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA 2 GAPDH
Plasmid#83809PurposeExpress Sg-2 sgRNA targeting GAPDHDepositorInsertSgRNA
UseCRISPRAvailable SinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
psgRNAv1-empty
Plasmid#171611PurposesgRNA_v1 plasmid for AsCas12f1 in bacteriaDepositorInsertAsCas12f1_sgRNA_1
ExpressionBacterialAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only