We narrowed to 18,385 results for: nar
-
Plasmid#124552PurposeChimeric ETS domain: Wing of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationThe 5 residues making up the "wing" in …Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pET28B-PU.1-ETS-H3/S3
Plasmid#124627PurposeChimeric ETS domain: H3/S3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 237 to 241 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q03JI6
Plasmid#103123PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ03JI6 (Cas9 coding gene from Campylobacter jejuni)
UseCRISPR; Cloning vectorTagsSV40NLSMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTreTight-Htt94Q-CFP
Plasmid#23966DepositorInsertN-terminal fragment Huntingtin Q94 (HTT Human)
TagsCFPExpressionMammalianMutation94 polyQ repeatAvailable SinceApril 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA GNSTM-3-RVG-10-Lamp2b-HA
Plasmid#71294PurposeEncodes (N to C): GNSTM glycosylation motif, 3 residue spacer, RVG peptide, 10 residue spacer, Lamp2b (exosomal transmembrane protein), 3 residue spacer, HA tag.DepositorInsertLamp2b (LAMP2 Human)
TagsGNSTM glycosylation motif, HA, Lamp2 signal pepti…ExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQE80L-SpyCatcher-ELP-GFP
Plasmid#69835PurposeBacterial expression plasmid containing SpyCatcher-ELP-GFP fusion. SpyCatcher forms a covalent bond with SpyTag and can be used to label plasma membrane localized SpyTag-C1C2 in live cells.DepositorInsertSpyCatcher-ELP-GFP
Tags6x His Tag, GFP, and TEV TagExpressionBacterialPromoterT5 promoter/lac operator elementAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pDONR221 MLK1
Plasmid#60540PurposeDonor vector for human MLK1DepositorInsertMLK1 (MAP3K9 Human)
UseGateway donor vectorAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
LARG mCherry sspB in pcDNA3.1
Plasmid#90459PurposeRhoA mediated cell migrationDepositorInsertsExpressionMammalianMutationR73QPromoterCMVAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
LARG mtq sspB in pcDNA3.1
Plasmid#90460PurposeRhoA mediated cell migrationDepositorInsertsExpressionMammalianMutationR73Q and deletion a.a. (234-239)Available SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 MLK1 E179K
Plasmid#60541PurposeDonor vector for human MLK1 E179K mutantDepositorAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 MLK1 D294A
Plasmid#60542PurposeDonor vector for human MLK1 D294A mutantDepositorAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pLenti-CaMKIIa-SpyTag-C1C2-mCherry
Plasmid#69833PurposeLentiviral vector with CaMKIIa promoter and upstream CMV promoter expressing SpyTag-C1C2-mCherry fusion. SpyTag can be used to monitor membrane localization of the C1C2 opsin.DepositorInsertSpyTag-C1C2
UseLentiviralTagsTrafficking signal and mCherryExpressionMammalianMutationInserted SpyTag after the signal peptide of C1C2.PromoterCamKIIaAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1-CHRFAM7ADelta2bp
Plasmid#62515Purposemammalian expression of human duplicated Alpha7 with 2 bp deletion (CHRFAM7A-∆2bp)DepositorInsertCHRFAM7ADelta2bp (CHRFAM7A Human)
ExpressionMammalianMutationpartially duplication of CHRNA7 with 2-bp deletio…PromoterCMVAvailable SinceMarch 20, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTriEx4-ADCY6-C2 (917-1165 aa)
Plasmid#113904PurposeHis-S tagged cytoplasmic catalytic domain 2 of Adenylate Cyclase 6DepositorInsertAdenylate Cyclase 6 cytoplasmic catalytic domain 2 (ADCY6 Human)
TagsHis-SExpressionBacterial, Insect, and Mamm…MutationPlease see Depositor CommentsPromoterT7, CMVAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only