We narrowed to 3,439 results for: aaas
-
Plasmid#64330Purposeura3 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of ura3 deletion gRNA cassette
ExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRelA'
Plasmid#175595PurposeTet inducible, KAN Resistant, non labelled synthesis domain of the E. coli relA gene on a low copy backbone. Used to induce controllable synthesis of ppGpp in E. coli.DepositorInsertCatalytic domain of E.coli relA gene.
ExpressionBacterialMutationOnly the catalytic domain of the enzyme is used (…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMesh1
Plasmid#175594PurposeLac inducible, AMP Resistant, non labelled gene mesh1 from D. melanogaster on a low copy backbone. Used to induce controllable hydrolysis of ppGpp in E. coli.DepositorInsertMesh1 (Mesh1 Fly)
ExpressionBacterialMutationCodon optimized for translation in E.coli. AGGAGG…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg14x(MS2) MUC4.1
Plasmid#101153PurposegRNA with 14 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 MUC4.1
Plasmid#101152PurposegRNA with two MCP binding sitesDepositorAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-PRMT9 L182A/D183A/I184A/G185A
Plasmid#67608Purposebacterial expression of catalytically inactive GST-PRMT9 LDIG(182-185)AAAA mutantDepositorInsertPRMT9 (PRMT9 Human)
TagsGSTExpressionBacterialMutationcatalytic mutant LDIG(182-185)AAAAPromotertacAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-41_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211681PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-41 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-AB4
Plasmid#185513PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationIDILGE replaced with AAAAAAAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-AB2
Plasmid#185512PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationIDIL replaced with AAAAAAAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-A6-myc
Plasmid#185507PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionTagsmycMutationFSIENIM to AAAAAAMAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRelA*
Plasmid#175590PurposeTet inducible, KAN Resistant, fluor labelled (YFP) synthesis domain of the E. coli relA gene on a low copy backbone. Used to induce controllable synthesis of ppGpp in E. coli.DepositorInsertCatalytic domain of E.coli relA gene.
TagsFused with a flexible GS linker to mVenusExpressionBacterialMutationOnly the catalytic domain of the enzyme is used (…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMesh1*
Plasmid#175591PurposeLac inducible, AMP Resistant, fluor labelled (CFP) gene mesh1 from D. melanogaster on a low copy backbone. Used to induce controllable hydrolysis of ppGpp in E. coli.DepositorInsertMesh1 (Mesh1 Fly)
TagsFused with a flexible GS linker to ceruleanExpressionBacterialMutationCodon optimized for translation in E.coli. AGGAGG…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
PBLO CasX-gRNA
Plasmid#126419PurposeE. coli vector for CasX gRNA --- Used for In Vitro TranscriptionDepositorInsertcasX gRNA
UseCRISPR; In vitro transcriptionAvailable SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
MIS18BP1 F9.1 gRNA
Plasmid#90768Purpose3rd generation lentiviral gRNA plasmid targeting human MIS18BP1DepositorInsertMIS18BP1 (Guide Designation F9.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGGA-FT guide RNA1_7
Plasmid#246797PurposeA GreenGate entry vector containing a guide RNA expression cassette targeting the AtFT gene with 7 different gRNAsDepositorInsertAtU6-1 promoter-FT guide RNA1-AtU6-1 promoter-FT guide RNA3- (FT Synthetic, Mustard Weed)
UseCRISPR; Greengate cloning entry vectorExpressionPlantAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgFah.Intron9.CMV/CB-EGFP
Plasmid#121509PurposeExpresses sgRNA targeting mouse Fah intron 9 (sgFah.Intron9).DepositorInsertsgFah.intron9
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1B gRNA (BRDN0001147624)
Plasmid#77083Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgYME1L1 sg2
Plasmid#244868PurposeKnockout of human YME1L1DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only