We narrowed to 3,492 results for: aaas
-
Plasmid#131257PurposepX330-U6-Chimeric_BB-Cbh-hSpCas9 vector expressing a guide RNA targeting exon 3 of USP7DepositorInserthumanised S. pyogenes Cas9 nuclease
ExpressionMammalianAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM/CBA-eGFP-miRaSyn(human)x3-WPRE-bGHpA
Plasmid#194247PurposeExpresses 3 miRNAs targeting human alpha-SynucleinDepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHW1143
Plasmid#229866PurposeEntry vector with FRT-SA-ArtificialExon-3xStopCodons-SL2-AAAA in slot 4 (for SapTrap assembly)DepositorInsertFRT-SA-ArtificialExon-3xStopCodons-SL2-AAAA
ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-A6
Plasmid#185506PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationFSIENIM to AAAAAAMAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
LEP-shTADA1.1226
Plasmid#105567Purposeretrovirally express TADA1 shRNA with puro resistance and GFP markerDepositorInsertTADA1 shRNA
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg14x(MS2) MUC4.1
Plasmid#101153PurposegRNA with 14 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 16x(MS2) MUC4.1
Plasmid#101154PurposegRNA with 16 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
gRNA-ura-HYB
Plasmid#64330Purposeura3 deletion gRNA cassette carried by pRS42HDepositorInsertgBlock product of ura3 deletion gRNA cassette
ExpressionYeastAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRelA'
Plasmid#175595PurposeTet inducible, KAN Resistant, non labelled synthesis domain of the E. coli relA gene on a low copy backbone. Used to induce controllable synthesis of ppGpp in E. coli.DepositorInsertCatalytic domain of E.coli relA gene.
ExpressionBacterialMutationOnly the catalytic domain of the enzyme is used (…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMesh1
Plasmid#175594PurposeLac inducible, AMP Resistant, non labelled gene mesh1 from D. melanogaster on a low copy backbone. Used to induce controllable hydrolysis of ppGpp in E. coli.DepositorInsertMesh1 (Mesh1 Fly)
ExpressionBacterialMutationCodon optimized for translation in E.coli. AGGAGG…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 MUC4.1
Plasmid#101152PurposegRNA with two MCP binding sitesDepositorAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-PRMT9 L182A/D183A/I184A/G185A
Plasmid#67608Purposebacterial expression of catalytically inactive GST-PRMT9 LDIG(182-185)AAAA mutantDepositorInsertPRMT9 (PRMT9 Human)
TagsGSTExpressionBacterialMutationcatalytic mutant LDIG(182-185)AAAAPromotertacAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfb13221
Plasmid#219896PurposeThe base plasmid of TUNEYALI for TF31DepositorInsertContains gRNA targeting TF31 (YALI1_D18727g) and homologous arm matching TF31
ExpressionYeastAvailable SinceJune 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-41_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211681PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-41 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-AB4
Plasmid#185513PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationIDILGE replaced with AAAAAAAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-AB2
Plasmid#185512PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationIDIL replaced with AAAAAAAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-A6-myc
Plasmid#185507PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionTagsmycMutationFSIENIM to AAAAAAMAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRelA*
Plasmid#175590PurposeTet inducible, KAN Resistant, fluor labelled (YFP) synthesis domain of the E. coli relA gene on a low copy backbone. Used to induce controllable synthesis of ppGpp in E. coli.DepositorInsertCatalytic domain of E.coli relA gene.
TagsFused with a flexible GS linker to mVenusExpressionBacterialMutationOnly the catalytic domain of the enzyme is used (…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMesh1*
Plasmid#175591PurposeLac inducible, AMP Resistant, fluor labelled (CFP) gene mesh1 from D. melanogaster on a low copy backbone. Used to induce controllable hydrolysis of ppGpp in E. coli.DepositorInsertMesh1 (Mesh1 Fly)
TagsFused with a flexible GS linker to ceruleanExpressionBacterialMutationCodon optimized for translation in E.coli. AGGAGG…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only