We narrowed to 3,403 results for: aaas
-
Plasmid#175594PurposeLac inducible, AMP Resistant, non labelled gene mesh1 from D. melanogaster on a low copy backbone. Used to induce controllable hydrolysis of ppGpp in E. coli.DepositorInsertMesh1 (Mesh1 Fly)
ExpressionBacterialMutationCodon optimized for translation in E.coli. AGGAGG…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg14x(MS2) MUC4.1
Plasmid#101153PurposegRNA with 14 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 MUC4.1
Plasmid#101152PurposegRNA with two MCP binding sitesDepositorAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-PRMT9 L182A/D183A/I184A/G185A
Plasmid#67608Purposebacterial expression of catalytically inactive GST-PRMT9 LDIG(182-185)AAAA mutantDepositorInsertPRMT9 (PRMT9 Human)
TagsGSTExpressionBacterialMutationcatalytic mutant LDIG(182-185)AAAAPromotertacAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-41_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211681PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-41 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-AB4
Plasmid#185513PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationIDILGE replaced with AAAAAAAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-AB2
Plasmid#185512PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionMutationIDIL replaced with AAAAAAAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2-foxd4l1.1-A6-myc
Plasmid#185507PurposeExpression of Xenopus laevis foxd4DepositorInsertfoxd4l1.1
UseIn vitro transcriptionTagsmycMutationFSIENIM to AAAAAAMAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRelA*
Plasmid#175590PurposeTet inducible, KAN Resistant, fluor labelled (YFP) synthesis domain of the E. coli relA gene on a low copy backbone. Used to induce controllable synthesis of ppGpp in E. coli.DepositorInsertCatalytic domain of E.coli relA gene.
TagsFused with a flexible GS linker to mVenusExpressionBacterialMutationOnly the catalytic domain of the enzyme is used (…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMesh1*
Plasmid#175591PurposeLac inducible, AMP Resistant, fluor labelled (CFP) gene mesh1 from D. melanogaster on a low copy backbone. Used to induce controllable hydrolysis of ppGpp in E. coli.DepositorInsertMesh1 (Mesh1 Fly)
TagsFused with a flexible GS linker to ceruleanExpressionBacterialMutationCodon optimized for translation in E.coli. AGGAGG…Available SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
PBLO CasX-gRNA
Plasmid#126419PurposeE. coli vector for CasX gRNA --- Used for In Vitro TranscriptionDepositorInsertcasX gRNA
UseCRISPR; In vitro transcriptionAvailable SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
MIS18BP1 F9.1 gRNA
Plasmid#90768Purpose3rd generation lentiviral gRNA plasmid targeting human MIS18BP1DepositorInsertMIS18BP1 (Guide Designation F9.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgFah.Intron9.CMV/CB-EGFP
Plasmid#121509PurposeExpresses sgRNA targeting mouse Fah intron 9 (sgFah.Intron9).DepositorInsertsgFah.intron9
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1B gRNA (BRDN0001147624)
Plasmid#77083Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgYME1L1 sg2
Plasmid#244868PurposeKnockout of human YME1L1DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-73kb-DSF
Plasmid#227499Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 73kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-66kb-DSF
Plasmid#227497Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 66kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only