We narrowed to 10,082 results for: crispr plasmids
-
Plasmid#154430Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vectorDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR C terminal AAV vector
UseAAV and CRISPRExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgGFP_3
Plasmid#78165PurposesgGFPDepositorInsertGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-BrCas12b-FNLDTA
Plasmid#195340PurposeExpresses Engineered BrCas12b in BacteriaDepositorInsertBrCas12b
UseCRISPR and Synthetic BiologyTags6xHis Tag and MBP, TEV cleavage site, 6x His TagExpressionBacterialMutationF208W, N524V, L795I, D868V, T874S, A1015EPromoterT7 PromoterAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV2 ITR_phU6_gRNA scaffold-DMD sg1_phU6_gRNA scaffold-DMD sg16_pMHCK7-3x Flag-NLS-ecDHFR-enOsCas12f1-NLS-ecDHFR_pA_AAV2 ITR
Plasmid#197029PurposeAAV vector encoding a human codon-optimized ecDHFR-enOsCas12f1-ecDHFR driven by MHCK7 promoter, DMD-targeting guide RNAs compatible with enOsCas12f1 driven by hU6DepositorInserthumanized ecDHFR-enOsCas12f1-ecDHFR
UseAAVMutationD52R / T132RPromoterMHCK7, hU6Available SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-SpCas9_gRNA(RHO-P23H)-CMV-mTagBFP2_(RAS3613)
Plasmid#228252PurposepU6 (human U6) expression of SpCas9 sgRNA targeting RHO P23H mutation and pCMV expression of mTagBFP2DepositorInsertSpCas9 P23H sgRNA, mTagBFP2
ExpressionMammalianMutationn/aPromoterCMV and U6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-STU
Plasmid#138110PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized LbCas12a without promoter and terminatorDepositorInsertLbCas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA3
Plasmid#99736PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-FnCas9ABEmax8.17d
Plasmid#201955PurposeMammalian expression plasmid of FnCas9ABEmax8.17d base editor with T2A-EGFP and cloning backbone for sgRNADepositorInsertbpNLS-FnCas9ABEmax8.17d-bpNLS-3xHA-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD11A on FnCas9, V82S, V106W, Q154R on mutant TadAPromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ239-STU
Plasmid#138112PurposeGateway entry plasmid (attL1 & attR5) expressing rice codon optimized FnCas12a without promoter and terminatorDepositorInsertFnCas12a
UseCRISPR; Gateway compatible cas12a entry cloneTagsNLSExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-mCherry-ZIM3-KRAB
Plasmid#154473PurposeExpresses dCas9 fused to mCherry and the KRAB domain of ZIM3DepositorInsertZIM3 (ZIM3 Human)
UseLentiviralTagsHAExpressionMammalianMutationIncludes ZIM3 aa 1-100PromoterSFFVAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC081: pAAV.CMV.mCherry
Plasmid#205744PurposeAAV vector for expressing CMV-driven mCherry reporter gene.DepositorInsertmCherry
UseAAVExpressionMammalianPromoterCMVAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTransposon.CAG.CasRX-P2A-Blast
Plasmid#212965PurposeEpisomal plasmid encoding CasRx-P2A under the control of the CAG promoter. The construct is flanked by PB and SB repeats for integration into the cell genome.DepositorInsertCasRx
UseTransposonTagsP2A-Blasticidin resistanceExpressionMammalianPromoterCAGGSAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-Actin
Plasmid#119870PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse Beta ActinDepositorInsertbeta Actin (Actb Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
(559) pAAV EF-1a KRAB-SadCas9 U6-gRNA
Plasmid#163024PurposeExpression of CRISPRi with U6-gRNA (Bsa1 sites)DepositorInsertMammalian codon-optimized SadCas9
UseAAVTagsKRAB, SV40 polyA, and myc NLSExpressionMammalianPromoterhEF-1aAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.pU1a-SpCas9
Plasmid#121507PurposeExpresses codon-optimized SpCas9 in mammalian cells.DepositorInsertSpCas9
UseAAVTagsHAExpressionMammalianPromoterU1aAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ203 (pMDC32-Ubi1)
Plasmid#86207PurposeMultisite Gateway T-DNA entry plasmid (attR1 & attR2); Zea mays Ubi1 promoter and Hygromycin resistance markerDepositorTypeEmpty backboneUseGateway compatible attr1-attr2 destination vectorExpressionPlantPromoterMaize ubiquitin 1 (ZmUbi1)Available SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
FMR1-E17C-3xFLAG
Plasmid#157784Purposedonor plasmid for C-terminal FLAG tag fusion of human FMR1DepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-DNMT3a(R887E)-DNMT3l
Plasmid#154141PurposeExpresses a higher specificity variant of scFv-GCN4-DNMT3a-DNMT3l, contains R887E mutation in DNMT3a. To be used with the dCas9-SunTag system for targeted DNA methylation.DepositorInsertscFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
TagsHA and sfGFPExpressionMammalianMutationR887EPromoterSFFVAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-camk2a
Plasmid#104589PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse camk2aDepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterNoneAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only