We narrowed to 18,383 results for: URE
-
Plasmid#135999PurposeG3BP1 with RNA binding domains deleted inserted with GFP tagged on the N-terminusDepositorInsertG3BP1 (G3BP1 Human)
TagsEGFPExpressionMammalianMutationC-term of G3BP1 Deleted for Delta RBPAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-G3BP1-S149A
Plasmid#135998PurposeS149A G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cellsDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-His-MS2BP-G3BP1-WT
Plasmid#136008PurposeWT G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCW57-GFP-2A-MCS
Plasmid#71783PurposeAll-in-one doxycycline inducible lentiviral vector for expression of one gene in combination with turbo GFP using the P2A self-cleaving peptide.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Doxycycline inducible; p2a self cleav…ExpressionMammalianAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pB-EF1a-CuO-KRAB-dCas9-BFP-CymR-Puro
Plasmid#248161PurposeExpresses KRAB fused to dCas9 and BFP upon cumate inductionDepositorInsertsKRAB-dCas9-HA-tagBFP
HA-CymR-T2A-puro
UseCRISPRTagsHA and tagBFPExpressionMammalianPromoterEf1aAvailable SinceJan. 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Ring1bCD
Plasmid#235574PurposeDox-inducible expression of the catalytic-domain (CD) of epigenetic effector Ring1b fused with scFV to programme H2AK119ub.DepositorInsertRing1b (Rnf2 Mouse)
UseCRISPRAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 MYC
Plasmid#176045PurposeExpresses Myc in Mammalian cellsDepositorInsertMyc
ExpressionMammalianPromoterCMVAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET11a-SUMO1
Plasmid#53138PurposeE.coli expression of untagged mature human SUMO1 (amino acids 1-97)DepositorAvailable SinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
HS-aPKC-CAAX-GFP
Plasmid#105946Purposeheat shock inducible transgenesisDepositorAvailable SinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-p97
Plasmid#85670PurposeExpression of p97 with N-terminal GFP tagDepositorAvailable SinceMarch 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
[#GS5-RV] MitoTRACER-Donor
Plasmid#233505PurposeRetroviral construct of the MitoTRACER genetic reporter to be expressed in the donor cellsDepositorInsertMitoTRACER-Donor
UseRetroviral and Synthetic BiologyTagsGFP11 and HA TagExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-GLT1a
Plasmid#162515PurposeRat GLT-1a cDNA N-terminally tagged with EGFPDepositorAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby
Plasmid#71760PurposemGFP and Synaptophysin-mRuby expression from Cre-expressing neuronsDepositorHas ServiceAAV1InsertsmGFP
Synaptophysin
UseAAV and Cre/LoxTagsPalmitoylation signal and mRubyAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-GFP-Sec61β
Plasmid#186597PurposeThird generation lentiviral vector expressing GFP-Sec61βDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCSD_1xNLS-SaCas9-1xNLS-3xHA-1xNLS
Plasmid#107317PurposeExpresses SaCas9 in mammalian cellsDepositorInsertSaCas9
UseCRISPRTags3xHA and 2xNLS and NLSExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAM233
Plasmid#226655PurposepcDNA3.1-p97-FLAGDepositorAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-Ftractin-mCherry
Plasmid#85131Purposelentiviral expression of an F-actin live-cell marker (mCherry)DepositorInsertFtractin-mCherry (amino acids 9-52 of rat ITPKA, C-temrinally tagged with mCherry)
UseLentiviralTagsmCherryPromoterEF1aAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-APOBEC1-YTH
Plasmid#178949PurposeLentiviral vector for dox-inducible expression of APOBEC1-YTH in mammalian cellsDepositorInsertAPOBEC1-YTH-T2A-GFP
UseLentiviral and Synthetic Biology; InducibleTagsHAExpressionMammalianPromotertight TREAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only