We narrowed to 3,266 results for: pEGFP
-
Plasmid#58469PurposeExpresses a nuclear-targeted monomeric actin reporter, consisting of the RPEL1 domain from MAL/MRTF, on a CMV promoterDepositorInsertsTagsEGFPExpressionMammalianPromoterCMVAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pEGFP-C1 Utr230-EGFP-3XNLS
Plasmid#58466PurposeExpresses a nuclear-targeted actin filament reporter, consisting of the first 230 amino acids of human utrophin, on a CMV promoterDepositorInsertsTagsEGFPExpressionMammalianPromoterCMVAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MRLC1 T18D, S19D
Plasmid#35682DepositorAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MRLC T18A,S19A
Plasmid#35681DepositorAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hsRPA70 (MSW#473)
Plasmid#208067PurposeExpression of GFP-tagged hsRPA1 in human cellsDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Centrin2 (Nigg UK185)
Plasmid#41147DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hsRPA32 (MSW#497)
Plasmid#208068PurposeExpression of GFP-tagged hsRPA2 in human cellsDepositorAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hsRPA14 (MSW#503)
Plasmid#208069PurposeExpression of GFP-tagged hsRPA3 in human cellsDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-phSyn-flex-SypEGFP
Plasmid#153203PurposeCan be used to generate AAV virus that will mark the presynaptic terminal (synaptophysin-fused) EGFP in the presence of Cre in neurons from the synapsin promoterDepositorInsertsynaptophysin-EGFP
UseAAVPromoterrat synapsinAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 human cofilin S3E
Plasmid#50861Purposeexpresses psuedo-phosporylated, non-activatable cofilin fused to EGFP in mammalian cellsDepositorInsertcofilin 1 S3E (CFL1 Human)
TagsEGFPExpressionMammalianMutationS3E psuedo-phosporylated, non-activatablePromoterCMVAvailable SinceFeb. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 human cofilin S3A
Plasmid#50860Purposeexpresses constituvely active cofilin fused to EGFP in mammalian cellsDepositorInsertcofilin 1 S3A (CFL1 Human)
TagsEGFPExpressionMammalianMutationS3A constitutively activePromoterCMVAvailable SinceFeb. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C2-MVP delta607-623aa
Plasmid#204544PurposeExpresses EGFP-tagged MVP delta607-623aa in mammalian cellsDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-TetR-NLS-VP16
Plasmid#103834PurposeTranscription activator (transactivation domain of viral VP16 protein) that is constitutively recruited tetO arraysDepositorAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1X-Nup93-mut
Plasmid#87335PurposeTo express human Nup93 in mammalian cells. It contains synonymous mutations that are not targeted by shRNADepositorInsertNUP93 (NUP93 Human)
TagsEGFPExpressionMammalianMutationshRNA resistant changesPromoterCMVAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-human lyn–GFP
Plasmid#35958PurposeExpresses human lyn protein codon optimized for zebrafish expression.DepositorAvailable SinceApril 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-beta1-EGFP
Plasmid#160978PurposeExpresses a human myelin oligodendrocyte glycoprotein isoform beta1 - EGFP fusion protein in mammalian cellsDepositorInsertHomo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant beta1 (MOG Human)
TagsEGFPExpressionMammalianAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP PICH (Nigg CB62)
Plasmid#41163DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC1-FLAG-Synaptojanin 1-170
Plasmid#22294DepositorAvailable SinceDec. 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Cep164 (Nigg CW324)
Plasmid#41149DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only