We narrowed to 3,324 results for: pEGFP
-
Plasmid#40040DepositorInserthSlp4-a linker (SYTL4 Human)
TagsEGFPExpressionMammalianMutationlinker domain (144-353)PromotercmvAvailable SinceOct. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT)
Plasmid#196702PurposePlasmid for transient mammalian expression of wild type RNase H1 tagged with 2xNLS and EGFP that can be used to specifically degrade the nuclear R-loops.DepositorInserthuman RNaseH1 wild type
ExpressionMammalianAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 human cofilin S3E
Plasmid#50861Purposeexpresses psuedo-phosporylated, non-activatable cofilin fused to EGFP in mammalian cellsDepositorInsertcofilin 1 S3E (CFL1 Human)
TagsEGFPExpressionMammalianMutationS3E psuedo-phosporylated, non-activatablePromoterCMVAvailable SinceFeb. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 human cofilin S3A
Plasmid#50860Purposeexpresses constituvely active cofilin fused to EGFP in mammalian cellsDepositorInsertcofilin 1 S3A (CFL1 Human)
TagsEGFPExpressionMammalianMutationS3A constitutively activePromoterCMVAvailable SinceFeb. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-FUS/TLS-FLAGC
Plasmid#60362PurposePlasmid for expression of FLAG-GFP tagged human FUS/TLS (C-terminal tag). Confers resistance to G418.DepositorAvailable SinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Cep170 (Nigg PID200)
Plasmid#41150DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_mNG2(11)_Clathrin light chain
Plasmid#82608PurposeExpresses mNG2(11) tagged clathrin light chain in mammalian cellsDepositorInsertmNG2(11)_Clathrin light chain
ExpressionMammalianAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP - FLAG-APEX2- hs Lamin B1
Plasmid#139442PurposeAPEX2-Lamin B1 expression plasmidDepositorInsertLMNB1 (LMNB1 Human)
Tags3xGGGGS linker (between APEX2 and Lamin B1), APEX…ExpressionMammalianPromoterCMVAvailable SinceMay 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pegfp-N1-TFEB-S3A,R4A
Plasmid#44446DepositorInsertTFEB (TFEB Human)
TagsGFPExpressionMammalianMutationChanged both Serine 3 and Arginine 4 to AlaninePromoterCMVAvailable SinceApril 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 Lifeact-EGFP-2XNLS
Plasmid#58467PurposeExpresses a nuclear-targeted actin filament reporter, consisting of the peptide Lifeact, on a CMV promoterDepositorInsertsLifeact
2X NLS with 2X stop codons
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MRLC1 T18D, S19D
Plasmid#35682DepositorAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
mCherry-7aa-cb5-pEGFP-C1
Plasmid#177407PurposeTo express mCherry fused to endoplasmic reticulum (ER) targeting sequence "Cb5". mCherry faces the cytosol.DepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C2-MVP delta607-623aa
Plasmid#204544PurposeExpresses EGFP-tagged MVP delta607-623aa in mammalian cellsDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-alpha1-EGFP
Plasmid#126463PurposeExpression a human MOG (isoform alpha1) EGFP fusion protein in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Venus-30aa-Noxa-pEGFP-C1
Plasmid#166762PurposeTo increase the length of the linker between Venus and Noxa proteinsDepositorAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-phSyn-flex-SypEGFP
Plasmid#153203PurposeCan be used to generate AAV virus that will mark the presynaptic terminal (synaptophysin-fused) EGFP in the presence of Cre in neurons from the synapsin promoterDepositorInsertsynaptophysin-EGFP
UseAAVPromoterrat synapsinAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 Utr230-EGFP-3XNLS
Plasmid#58466PurposeExpresses a nuclear-targeted actin filament reporter, consisting of the first 230 amino acids of human utrophin, on a CMV promoterDepositorInsertsTagsEGFPExpressionMammalianPromoterCMVAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-Cep123 (CCDC123/Cep89)
Plasmid#67787PurposeThis plasmid encodes EGFP fused to the N-terminus of isoform 1 of Cep123 (CCDC123/Cep89)DepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Centrin2 (Nigg UK185)
Plasmid#41147DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only