We narrowed to 151,951 results for: ELL
-
Plasmid#104547PurposeExpresses Cry2-mCherry-PKA W196R/F327A in mammalian cells.DepositorInsertCry2-mCherry-PKA W196R/F327A
TagsmCherryExpressionMammalianMutationPKA W196R and Y204APromoterCMVAvailable SinceMarch 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
LB360 (Bcl-2 from -1287 to -1337)
Plasmid#15242DepositorInsertB-cell lymphoma/leukemia-2 (BCL2 Human)
UseLuciferaseTagsLuciferaseExpressionBacterialMutationBcl-2 fragment from -1287 to -1337 with P1Available SinceAug. 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMXs-HOXA9
Plasmid#131608Purposeexpression of human HOXA9 in mammalian cellsDepositorAvailable SinceDec. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
33-G-X1-pEF1-puro
Plasmid#111604PurposeExpress human 33-G-X1 in 293T cellsDepositorInserthuman LRRC33 and GARP chimeria (NRROS Human)
TagsFlag tagExpressionMammalianPromoterEF1aAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
binder/tag-WT-FAK-insertionA
Plasmid#190439PurposeThe tag is SsrA (AANDENY). Tag is inserted after R35 of FAK.DepositorAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-53_Dual_sgRNA
Plasmid#178107PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-53 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-53 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Scara3-IRES-BFP
Plasmid#117265PurposeRetroviral overexpression of Scara3DepositorInsertScara3 (Scara3 Mouse)
UseRetroviralExpressionMammalianMutationSee depositor comments below.PromoterLTRAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
TIRAP-TAP_IRES_GFP
Plasmid#52740PurposeRetroviral vector expresses hTIRAP-3xHA and a target site for the biotin ligase BirA upstream of IRES and GFPDepositorInsertToll/IL-1 Receptor adaptor protein (TIRAP Human)
UseRetroviralTags3x HA, 3x TEV, and BirA target siteExpressionMammalianAvailable SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSR06
Plasmid#69152Purposeread-outloxN mCherry to GFP switch for integration on ttTi5605, Mos Chr IIDepositorInsertsmCherry
eGFP
UseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0 and codon-optimzed index…Promoterrps-27Available SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_MTOR_E2419K_Dual_pegRNA
Plasmid#178110PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 T804N-G6 and MTOR-E2419K pegRNAs from two independent U6 promoters.DepositorInsertATP1A1 G6 T804N pegRNA + MTOR-E2419K pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf221
Plasmid#12909PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf221
ExpressionMammalianAvailable SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf222
Plasmid#12910PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf222
ExpressionMammalianAvailable SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf264
Plasmid#12952PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf264
ExpressionMammalianAvailable SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf194
Plasmid#12882PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf194
ExpressionMammalianAvailable SinceDec. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAA3
Plasmid#154163PurposeFirefly luciferase under the control of 5 copies of: the enhancer for the Drosophila melanogaster Metchnikowin gene, 4 Rel1A-specific NF-_B sites, 3 GATA sites and 3 putative ecdysone-response elements, plus an additional NF-_B site.DepositorInsertFirefly luciferase
UseLuciferaseMutation20 wt NF-κB sites were replaced with Rel1A-specif…Available SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUD2 (OTU, aa 132-314)
Plasmid#61410PurposeExpresses human OTUD2 (OTU domain) in E. coli.DepositorInsertOTUD2 (YOD1 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-131 and aa 315-348.PromoterT7Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
KTK_247
Plasmid#180529PurposeEntry vector containing pTac promoterDepositorInsertpTac promoter
ExpressionBacterialAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCGN-HCF-1-C600
Plasmid#92324PurposeC-term of HCF-1 proteinDepositorInsertHCF-1 C-term 1436-2035 (HCFC1 Human)
TagsC-myc (EQKLISEED) and HAExpressionMammalianMutationAA 1436-2035PromoterCMVAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
P12p-bio
Plasmid#47726PurposeExpresses enzymatically monobiotinylated full-length P12p ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised P12p
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only