We narrowed to 13,427 results for: Green Fluorescent Protein
-
Plasmid#200084PurposeMammalian expression of wild-type PPM1HDepositorAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-mDlx-GFP-Fishell-1 (AAV8)
Viral prep#83900-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-mDlx-GFP-Fishell-1 (#83900). In addition to the viral particles, you will also receive purified pAAV-mDlx-GFP-Fishell-1 plasmid DNA. mDlx-driven expression of GFP in GABA-ergic interneurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable sinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS305-mAID-Nb(VHHGFP4)
Plasmid#198412PurposeExpress mAID-Nb(VHHGFP4) under the control of ADH1 promoter in budding yeastDepositorInsertmAID-Nb (VHHGFP4)
ExpressionYeastPromoterADH1 promoterAvailable sinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTS103 pHAGE2 CMVtetO2 MCS-22xGS-GFP
Plasmid#199356PurposeLentiviral transfer plasmid for doxycycline inducible expression of a C-terminally GFP-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianMutationWTAvailable sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-Rabaptin-5
Plasmid#199173PurposeExpresses GFP-Rabaptin-5 fusion in mammalian cellsDepositorInsertRabaptin-5 (RABEP1 Human)
TagsEGFPExpressionMammalianMutationContains Tyr 149 Ser substitution; insert starts …PromoterCMVAvailable sinceApril 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCENPTΔC-dCas9-3xGFP
Plasmid#198325PurposeExpresses CENPTΔC-dCas9-3xGFP protein in mammalian cells. When coupled with a guide RNA against a high repeat target locus, this can be applied to seed ectopic kinetochores at the target locusDepositorInsertCENPTΔC (CENPT Human)
UseLentiviralTagsEGFP x 3 and dCas9ExpressionMammalianMutationtruncation - encodes only amino acids 1-375PromoterCMV-TetOAvailable sinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-On-HTR6-RhoA sensor
Plasmid#189614PurposeTet-On cilia-targeted RhoA sensor (Xlone piggybac back-bone); HTR6-fused with a sGFP-mScarlet-I based sensorDepositorAvailable sinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-RAPH1ΔTBS
Plasmid#194859PurposeExpress eGFP-RAPH1 lacking the TBS domain (RAPH1 aa 2-92 deleted) in mammalian cells.DepositorInsertRAPH1 (RAPH1 Human)
TagseGFPExpressionMammalianMutationRAPH1 with amino acids 2-92 deletedPromoterCMVAvailable sinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
CB6-GFP-TAOK2 (K57A)
Plasmid#197114PurposeExpression of kinase-deficient GFP-tagged TAOK2 (K57A) / PSK1 (K57A) in mammalian cellsDepositorInsertTAOK2 (K57A) (TAOK2 Human)
TagsGFPExpressionMammalianMutationChanged K 57 to APromoterCMVAvailable sinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
-
pTRIP-SFFV-GFP-RELA
Plasmid#196629PurposeExpress GFP-RELADepositorAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Tau(T217A)
Plasmid#187025PurposeExpresses EGFP tagged human 2N4R tau (with T217A mutation) in mammalian cells with CMV promoterDepositorInsertMAPT (MAPT Human)
TagsEGFPExpressionMammalianMutationChanged Threonine 217 to AlaninePromoterCMVAvailable sinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EFS-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188771PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterEFSAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-SID4x-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188901PurposedCas9 with an N-term Sid4x fusion, a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1) fusion, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertSID-dCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1) fusion, P2A-GF…PromoterSFFVAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-SRGAP1
Plasmid#187269PurposeExpression of SRGAP1-EGFPDepositorAvailable sinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pv6_CBX7_Chromo_TAF3_Phd
Plasmid#179400PurposeCell line generation via recombination-mediated cassette exchange (RMCE) and stable expression of CBX7_Chromo - TAF3_PhdDepositorInsertCBX7_Chromo - TAF3_Phd
TagsAviTag and EGFPExpressionMammalianPromoterCAGGSAvailable sinceSept. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-hs-ALPS 1-ALPS2-EGFP
Plasmid#187113PurposeProtein ExpressionDepositorAvailable sinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP GFP-MOSPD2 RD/LD
Plasmid#186468PurposeExpression of human MOSPD2 (mutant R404D/L406D, unable to bind FFAT motifs) fused to EGFP in mammalian cellsDepositorInsertMOSPD2 motile sperm domain containing 2 (MOSPD2 Human)
UseRetroviralTagsEGFPExpressionMammalianMutationR404D/L406D (mutant unable to bind FFAT motifs)Available sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only