We narrowed to 1,613 results for: aav vector plasmid
-
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
1179_pAAV-U6-BbsI-gRNA-CB-EmGFP
Plasmid#89060PurposeAAV-gRNA cloning vector with GFP reporterDepositorInsertEmGFP
UseAAV and CRISPRExpressionMammalianPromoterChicken beta actin with partial CMV enhancerAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-R26-FLEX-mStr
Plasmid#135619PurposeDonor vector for genomic targeting of a CAG-FLEX-mStrawberry cassette to the mouse Rosa26 locusDepositorInsertCAG-FLEX-mStrawberry flanked by Rosa26 homology arms (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-DIO- alpha-MSH
Plasmid#239044PurposeOverexpression of alpha-MSHDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-DIO-beta-Endorphin
Plasmid#239043PurposeOverexpression of beta endorphinDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(AAVS1)-PGKpuro2ABFP-W
Plasmid#200459PurposeLentiviral vector expressing gRNA targeting human AAVS1DepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ08-pAAVsc.U6-tracrRNA
Plasmid#211816PurposeAAV vector expressing tracrRNA under U6 promoterDepositorInsertU6-tracrRNA
UseAAVExpressionMammalianPromoterU6Available SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-F14F15S-jGCaMP7s
Plasmid#178514PurposeAAV vector for Flpo recombinase dependent jGCaMP7sDepositorInsertjGCaMP7s
UseAAVExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV2 ITR_phU6_gRNA scaffold-DMD sg1_phU6_gRNA scaffold-DMD sg16_pMHCK7-3x Flag-NLS-ecDHFR-enOsCas12f1-NLS-ecDHFR_pA_AAV2 ITR
Plasmid#197029PurposeAAV vector encoding a human codon-optimized ecDHFR-enOsCas12f1-ecDHFR driven by MHCK7 promoter, DMD-targeting guide RNAs compatible with enOsCas12f1 driven by hU6DepositorInserthumanized ecDHFR-enOsCas12f1-ecDHFR
UseAAVMutationD52R / T132RPromoterMHCK7, hU6Available SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-VTKS2-Dreadd-hM3Dq-HA-P2A-tBFP
Plasmid#178707PurposeAAV vector for Cre-dependent transgene expression of Dreadd-hM3Dq-HA-P2A-tBFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertDreadd-hM3Dq-HA-P2A-tBFP
UseAAVPromoterhSynAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY59_TRAC-LHA-pAAV-EFS-CD22BBz-PRODH2(stop)-TRAC-RHA(3166mut)
Plasmid#192189PurposeCD22 CAR AAV vector PRODH2(StopCtrl) (pLY059)DepositorInsertCD22 CAR AAV vector PRODH2(StopCtrl) (pLY059) (CD22 Synthetic)
UseAAV; Mammalian expressionMutationNAAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR30 SCR
Plasmid#216393Purposetransfer plasmid for AAV vector production of mCherry and miR scramble (no target)DepositorInsertmcherry and miR control
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-PGC-1alpha-IRES-mCitrine
Plasmid#241791PurposeExpression vector for mouse Pgc-1alpha with mCitrineDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR5 Mm ATP10B
Plasmid#216391Purposetransfer plasmid for AAV vector production of mCherry and miR for Mm ATP10BDepositorInsertmcherry and miR Mm ATP10B
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMVenh synapsin-intron-mCherry-1x miR7 Rn ATP10B
Plasmid#216392Purposetransfer plasmid for AAV vector production of mCherry and miR for rat Rn ATP10BDepositorInsertmcherry and miR Rn ATP10B
UseAAVPromoterCMVenh synapsinAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-KRAB-pU6-sgRNA
Plasmid#158988PurposeVector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-KRAB
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV mGAD65(delE1) GFP WPRE SV40pA
Plasmid#177316PurposeTo produce the AAV vector that expresses GFP under the control of the mGAD65 promoter. The mGAD65 promoter has highly specificity to GABAergic interneurons.DepositorInsertmGAD65(delE1) promoter, GABAergic interneurons specific promoter
UseAAVAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CWB-yellow pre-eGRASP(p32)
Plasmid#111580PurposeAn AAV vector that expresses yellow pre-eGRASP(p32) under the CaMKIIa promoter.DepositorInsertyellow pre-eGRASP(p32)
UseAAVPromoterCaMKIIaAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CWB-cyan pre-eGRASP(p32)
Plasmid#111579PurposeAn AAV vector that expresses cyan pre-eGRASP(p32) under the CaMKIIa promoter.DepositorInsertcyan pre-eGRASP(p32)
UseAAVPromoterCaMKIIaAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CWB-cyan pre-eGRASP(p30)
Plasmid#111586PurposeAn AAV vector that expresses cyan pre-eGRASP(p30) under the CaMKIIa promoter.DepositorInsertcyan pre-eGRASP(p30)
UseAAVPromoterCaMKIIaAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only