We narrowed to 9,867 results for: Pol
-
Plasmid#156434PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA (all Zinc fingers point mutated), targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationAll zinc fingers mutatedAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAU002 - pTRE3G-CTCF(DELTA1-265)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156429PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationDELTA1-265Available SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAU003 - pTRE3G-Cterm_Nterm_switch_CTCF-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156430PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationCterm_Nterm_switchedAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-mCherry-P2A-T2A-nanobody-KS
Plasmid#238287PurposeFor integration of mCherry-P2A-T2A-nanobody-KSDepositorInsertmCherry-P2A-T2A-nanobody-KS
ExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_1_001
Plasmid#167347PurposeddPCR gating control for droplets containing all 5 targets (2 in pol)DepositorInsertpol_gag_tat_env
UseOtherAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-F-ELL2
Plasmid#49422PurposeMammalian expression of flag-tagged human ELL2DepositorAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9_AcrIIA5-AsLOV2(N77)
Plasmid#246056PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before N77) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-N77
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9_AcrIIA5-AsLOV2(D41)
Plasmid#246055PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before D41) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-D41
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN366 - pTRE3G-CTCF-mRuby2-BGHpA-CAGGS-rtta3G-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE donor
Plasmid#156432PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible wild-type CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N BKV ER
Plasmid#37864DepositorUseRetroviralTagsFlag and HAExpressionMammalianPromoterPKGAvailable SinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pUltra-MDH1-ME1
Plasmid#184465PurposeLentiviral vector for tri-cistronic expression of EGFP, MDH1 and ME1 (seperated by P2A and T2A)DepositorUseLentiviralTagsfused to T2AExpressionMammalianMutationdeletion of stop codonPromoterUbCAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLPC-puromycin-binary-MDH1-3xFLAG-ME1- HA
Plasmid#184549PurposeRetroviral vector to co-express human MDH1 with 3xFLAG tag and human ME1 with HA tagDepositorUseRetroviralTags3xFLAG and HA tagExpressionMammalianPromoterCMVAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Human Genome-Wide Reduced Double-gRNA library
Pooled Library#137999PurposeKnockout library that delivers random pairs of optimised gRNAs, reducing screens scale with similar performance to larger libraries.DepositorArticleSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ spike_del19
Plasmid#155297PurposeExpression of spike with C-term deletion of 19 aa, used to generate high efficiency SARS-CoV-2-pseudotyped lentiviral particlesDepositorInsertSARS-Cov2 spike_deleted (S SARS-Cov2)
UseGeneration of sars-cov-2-pseudotyped lentiviral p…MutationDeletion in C-term 19 aa of spikePromoterCMVAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHIPH4
Plasmid#117685PurposeHansenula polymorpha expression plasmidDepositorInsertAlcohol Oxidase promoter
ExpressionYeastPromoterAlcohol OxidaseAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pETM41-EcPPK
Plasmid#38334DepositorInsertE. coli polyphosphate kinase (ppk Escherichia coli)
Tags6xHIS, MBP, and TEVExpressionBacterialPromoterT7Available SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKM263-EcPPK
Plasmid#38333DepositorInsertE. coli polyphosphate kinase (ppk Escherichia coli)
Tags6xHIS, GST, and TEVExpressionBacterialPromoterT7Available SinceAug. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDKIER
Plasmid#37093DepositorExpressionMammalianPromoterCMVAvailable SinceJuly 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA2-MpCKB
Plasmid#238528PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKB
Plasmid#238527PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKA
Plasmid#238526PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 alphaDepositorInsertMpCKA
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB-327-Ef1-MpCKA-WT-TagRFP
Plasmid#238529PurposePlant expression of wild-type M. polymorpha CK2 alpha, tagged with TagRFP in plantsDepositorInsertMpCKA
TagsTagRFPExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.MCV.cLT206.V5(CM2B4)
Plasmid#28189DepositorInsertMCPyV Large T antigen (206 wild-type strain)
TagsV5ExpressionBacterial and MammalianAvailable SinceSept. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.MCV.LT206.V5(CM2B4)
Plasmid#28190DepositorInsertMCPyV genomic T antigen locus (206 wild-type strain)
TagsV5ExpressionBacterial and MammalianAvailable SinceMay 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB-327-Ef1-MpCKA-K151M-D258N-TagRFP
Plasmid#238530PurposePlant expression of M. polymorpha CK2 alpha K151M, D258N, tagged with TagRFP in plantsDepositorInsertMpCKA
TagsTagRFPExpressionPlantMutationK151M, D258NAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
mP_ILB_Vector 1
Plasmid#232193PurposeThe plasmid vector designed for the expression of four genes in oleaginous yeasts, including Yarrowia lipolytica and Rhodotorula toruloides.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceMarch 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pST44
Plasmid#64007Purposepolycistronic cloning vector for pST44 plasmid suiteDepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST39
Plasmid#64009Purposeoriginal polycistronic cloning vector for plasmid suite (generation I)DepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-ncpGCaMP6s
Plasmid#113674PurposeA topological variant of GCaMP6sDepositorInsertncpGCaMP6s
ExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGustiv
Plasmid#240335PurposeExpresses BK polyomavirus genotype IV capsid protein VP1 in yeast. Expression of VP1 (and a GFP reporter) is induced by maltose.DepositorInsertsBKV-IV VP1
Superfold GFP
Formaldehyde dehydrogenase 1
ExpressionYeastPromoterFDH1, MAL31, and MAL32Available SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Pig3 Promoter
Plasmid#16489DepositorAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLS406
Plasmid#231078PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker URA3DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS405
Plasmid#231077PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker LEU2DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS404
Plasmid#231076PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker TRP1DepositorTypeEmpty backboneUseIntegratingExpressionBacterial and YeastAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only