We narrowed to 46,263 results for: LIS;

#106300

The plasmid encodes mouse Synaptophysin sparsely labeled with SunTag24x_v4.

James Zhe Liu

Liu et al Proc Natl Acad Sci U S A. 2017 Dec 28. p

March 6, 2018

Academic Institutions and Nonprofits only

#87402

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#116006

destination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expression

Sebastien Wolf

Schurholz et al Plant Physiol. 2018 Jul 19. pii: pp.18.0

Dec. 11, 2018

Academic Institutions and Nonprofits only

#59392

Plasmid for bacterial overexpression of RBPMS

Thomas Tuschl

Farazi et al RNA. 2014 Jul;20(7):1090-102. doi: 10.12

Feb. 9, 2015

Academic Institutions and Nonprofits only

#116012

destination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expression

Thomas Greb

Schurholz et al Plant Physiol. 2018 Jul 19. pii: pp.18.0

Dec. 11, 2018

Academic Institutions and Nonprofits only

#87399

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#100126

It contains ~1.4Kb of the miR-183/96-182 cluster promoter

Eva Hernando

Segura et al Oncotarget. 2017 Apr 18;8(16):26298-2631

March 29, 2019

Academic Institutions and Nonprofits only

#87403

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#68553

This plasmid expresses full length IDAX.

Anjana Rao

Ko et al Nature. 2013 May 2;497(7447):122-6. doi:

Oct. 22, 2015

Academic Institutions and Nonprofits only

#84826

Minimos transposon with Psmu-1:smu-1:GFP:smu-1 UTR and cbr-unc-119 selection

Andrew Fire

Frokjaer-Jensen et al Cell. 2016 Jul 14;166(2):343-57. doi: 10

Jan. 20, 2017

Academic Institutions and Nonprofits only

#111603

Express human LRRC33 in 293T cells

Timothy Springer

Qin et al Cell. 2018 Jun 28;174(1):156-171.e16. do

Oct. 1, 2018

Academic Institutions and Nonprofits only

#113418

Expresses hA1-BE3 in mammalian cells

Jia Chen

Wang et al Nat Biotechnol. 2018 Aug 20. pii: nbt.41

Aug. 21, 2018

Academic Institutions and Nonprofits only

#92164

For lncRNA 4_pA(3_SV40 polyA and 1 BGH polyA) homologue recombination mediated knockin

Xiaohua Shen

Yin et al Cell Stem Cell. 2015 May 7;16(5):504-16.

March 29, 2019

Academic Institutions and Nonprofits only

#87394

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only