We narrowed to 1,717 results for: cag promoter
-
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC50
Plasmid#104824PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.08g081600, Glyma.05g126600 (Hen1ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.08g081600, Glyma.05g126600
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX601-Nlgn2-gRNA2-GfaABC1D-mCherry
Plasmid#250933PurposeNlgn2 gRNA #2 targeting Rat Nlgn2. Also expresses SaCas9 T2a mCherry under the astrocyte promoter gfaABC1DDepositorAvailable SinceJune 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
TDP-43 mRuby K84ONBK
Plasmid#216226PurposeTDP-43 with a C-terminal mRuby tag and Lysine 84 in the NLS mutated to a TAG stop codon for amber codon suppression.DepositorInsertTransactive response DNA binding protein of 43 kDa (TARDBP Human)
ExpressionMammalianMutationLysine 84 mutated to a TAG stop codonPromoterCMV PromoterAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPN273
Plasmid#91644PurposeExpress sgRNA targeting human MMP16DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
SBC015866
Plasmid#226280PurposeExpresses BsSfp, MsCAD, and SrCAR from trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLG1-puro-sgATL2-1
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFP60
Plasmid#247216PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (DF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with F30 scaffold)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCBASceI
Plasmid#26477PurposeI-SceI endonuclease expression vector with mammalian promoter to introduce a DSB at a genomic I-SceI siteDepositorInsertpCBASceI
TagsHAExpressionMammalianAvailable SinceOct. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
pISV-CRISPR/Cas9PGmUbi
Plasmid#209189PurposeExpression of Cas9 in the model legume Medicago truncatula, Gmubi promoter (PGmubi), DsRed and Basta selectionDepositorInsertsCas9
DsRed(deltaB)
TagsNLSExpressionPlantMutationmissing BsaI site and plant-codon optimized with …PromoterCaMV 35S and GmUbi from Glycine max (L.) Merr. cv…Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-1
Plasmid#223223Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgLIAS-1
Plasmid#251681PurposegRNA to knock out LIAS in mammalian cellsDepositorInsertLIAS lipoic acid synthetase (LIAS Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgETS1-1
Plasmid#251685PurposegRNA to knock out ETS1 in mammalian cellsDepositorInsertETS1 ETS proto-oncogene 1, transcription factor (ETS1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVUTHshGATA1-tTR-KRAB
Plasmid#11650PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generationDepositorInserthUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (GATA1 Human)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN262
Plasmid#91607PurposeExpress sgRNA targeting human EPHX2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN060
Plasmid#91593PurposeExpress sgRNA targeting human CYP26B1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN287
Plasmid#91670PurposeExpress sgRNA targeting human SLC45A1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-Fgf5Pro
Plasmid#227480Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-Fgf5Pro
Plasmid#227481Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-PrPro
Plasmid#227455Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-PrPro
Plasmid#227456Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
INS-CRa-Lsg-MS2
Plasmid#247478PurposesgRNA for INS activation cloned into LsgRNA-MS2 backboneDepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
B52 + PARP4 sgSTOP
Plasmid#100711PurposeB52 plasmid expressing PARP4 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PARP4 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only