We narrowed to 23,390 results for: HAL
-
Plasmid#117383PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFPDepositorHas ServiceAAV1InsertEYFP
UseAAVExpressionMammalianPromoterTREAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-2xNLS-mTurquoise2
Plasmid#118025PurposeAn AAV genome that expresses nuclear localized mTurquoise2 from the hSyn1 promoterDepositorInsert2xNLS-mTurquoise2
UseAAVTagsNLSPromoterhSyn1Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC-DELTA
Plasmid#53273PurposeContains crtE, crtB, and crtI genes of Erwinia herbicola (Pantoea agglomerans) Eho10, together with the lcyE gene of Arabidopsis thaliana and thereby produces delta-carotene in E. coliDepositorAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHLP700
Plasmid#203742PurposeC-terminal tagging of target proteins with AID*/3xHA degronDepositorInsertIAA17 auxin binding domain codons 71-114
UsePcr amplification template for gene taggingTags3xHAPromoternoneAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHLP701
Plasmid#203743PurposeC-terminal tagging of target proteins with 3xV5-IAA17 degronDepositorInsertIAA17 auxin binding domain
UsePcr amplification template for gene taggingTags3xV5PromoternoneAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSK267
Plasmid#129272Purpose"ZF only" yTRAP control to control for yTRAP reporter fluorescence changes not dependent on sensed proteinDepositorInsertNLS-VP16-ZF 43-8-NES
Tags6xHAExpressionYeastPromoterSUP35Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
35S::Cel1SP-GeNL/pCAMBIA1301
Plasmid#190069PurposeExpressing bioluminescent pH indicator-GeNL- in Arabidopsis thaliana apoplastDepositorInsertCel1 signal peptide-Green-enhanced Nano-lantern
ExpressionPlantPromoterCaMV 35SAvailable SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSK260
Plasmid#129252Purposedual yTRAP, NM fusion to aTF1 reporting on [PSI+] state with mKate2 reporterDepositorInsertSup35 NM yTRAP sensor reporting on mKate2
ExpressionYeastAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK234
Plasmid#131149Purposedual yTRAP, Gateway destination vector of aTF2 fusion reporting on mKate2DepositorTypeEmpty backboneUseGateway destination vectorExpressionYeastAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK247
Plasmid#131148Purposedual yTRAP, Gateway destination vector of aTF2 fusion reporting on mNeonGreenDepositorTypeEmpty backboneExpressionYeastPromoterpSUP35, min pCYC1Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSK226
Plasmid#129268Purposedual yTRAP, RNQ1 fusion to aTF2 reporting on [RNQ+] state with mNeonGreen reporterDepositorInsertRnq1
ExpressionYeastAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pAAV-hSyn1-eYFP
Plasmid#117382PurposeAn AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV2, AAV5, AAV8, and AAV9InsertEYFP
UseAAVExpressionMammalianPromoterhSyn1Available SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3
Plasmid#214922Purposeexpression vector control - contitutive expression of mClover3 aloneDepositorInsertmClover3
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
MuHKII-pGFPN3
Plasmid#21922DepositorInsertMutant huamn HKII (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK2 Human)
TagsGFPExpressionMammalianMutationThis is the full length human HKII cDNA sequence …Available SinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEG302_dCAS9-MQ1(Q147L)_g4+g10+g18
Plasmid#172316PurposeCRISPR dCas9 directly fused to a variant of bacterial DNA methyltransferase MQ1 to target CG specific methylation to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(Q147L)_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNH11 (pmyo-2::Arch(D95N)::2xMycTag)
Plasmid#130275PurposeExpresses the voltage sensor Arch(D95N) in the pharynx of C. elegans.DepositorInsertArch(D95N)
Tags2x Myc-tagExpressionWormAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGAN201
Plasmid#129204PurposeyTRAP sensor of [RNQ+], detects aggregation of Rnq1DepositorAvailable SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNH13 (pmyo-2::QuasAr::mOrange)
Plasmid#130273PurposeExpresses the eFRET-based voltage sensor QuasAr::mOrange in the pharynx of C. elegans.DepositorInsertQuasAr::mOrange
TagsmOrangeExpressionWormAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGAN200
Plasmid#129203PurposeyTRAP sensor of [PSI+], detects aggregation of Sup35DepositorInsertSup35NM (SUP35 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationN terminal and middle domainsPromoterSUP35Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-mRuby3
Plasmid#214923Purposeexpression vector control - contitutive expression of mRuby33 aloneDepositorInsertmRuby3
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEG302_dCAS9-MQ1(C141S,S317A)_g4+g10+g18
Plasmid#172317PurposeCRISPR dCas9 directly fused to a catalytic inactive version of bacterial DNA methyltransferase MQ1 to target to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_UBQ10_Ω_dCas9_MQ1(C141S,S317A)_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
-
pHD57 [Tol2-UAS:sypb-egfp-cry2-polyA]
Plasmid#198381PurposeExpression of SYPB::CRY2olig(535) in neurons of Danio rerioDepositorInsertUAS:sypb-egfp-cry2
UseTol2TagsEGFPMutationD387APromoterUASAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
MuHKI-pGFPN3
Plasmid#21919DepositorInsertMutant huamn HKI (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK1 Human)
TagsGFPExpressionMammalianMutationThis is the full length human HKI cDNA sequence w…Available SinceNov. 2, 2009AvailabilityAcademic Institutions and Nonprofits only -
ATG-1929
Plasmid#108712PurposeCBR2opt in pF4Ag expression vector with T7 and CMV promoterDepositorInsertCBR2opt
ExpressionBacterial and MammalianMutationPromega used directed evolution to create CBR (Cl…PromoterT7, CMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
sh-SRF
Plasmid#100797Purposeexpression of shRNA targeting SRFDepositorInsertrat SRF
UseRNAiPromoterH1Available SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIRESN2 H2B-GFP-uvr8at(2x)
Plasmid#44970DepositorTagsinternal GFPExpressionMammalianMutationtandem repeat of UVR8 (both have Methionine 1 del…PromoterpCMV IEAvailable SinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA1
Plasmid#166889PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-AHR-shRNA3
Plasmid#166909PurposeLentivirus for inducible knockdown of human AHRDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAB17 (punc-17::QuasAr)
Plasmid#214888PurposeExpresses the voltage sensor QuasAr2 in cholinergic neurons of C. elegans.DepositorInsertQuasAr2
ExpressionWormAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-SRRD-mRuby3
Plasmid#214920Purposeinducible expression of SRRD tagged on C-terminus with mRuby3DepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-noTag (in pLEX_307)
Plasmid#214919Purposeconstitutive expression of SRRD with no tag - used as control for SRRD-HA expressionDepositorInsertSRRD (SRRD Human)
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-HA (in pLEX_307)
Plasmid#214918Purposeconstitutive expression of SRRD tagged with HADepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEE071
Plasmid#176828PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert710
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE073
Plasmid#176830PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert712
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEE074
Plasmid#176831PurposeEncodes codon optimized putative thermophilic PET hydrolase enzyme for bacterial expressionDepositorInsert713
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP
Plasmid#58490PurposeExpresses Arch(D95Q)-eGFP in mammalian cells as a fluorescent reporter of membrane voltageDepositorInsertArchaerhodopsin-3 w/ D95H point mutation fused to eGFP
UseLentiviralTagseGFPExpressionMammalianMutationChanged Aspartic Acid 95 to GlutaminePromoterUbiquitinAvailable SinceAug. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
ATG-2460
Plasmid#108713PurposeEF1-CBR2opt-T2A-copGFP (construct used for lentiviral transduction)DepositorInsertCBR2opt-copGFP fusion
UseLentiviralTagsCBR2opt fused to copGFPMutationPromega used directed evolution to create CBR (Cl…Promoterelongation factor-1Available SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-V5-APEX2 (in pLEX_307)
Plasmid#214921Purposeconstitutive expression of SRRD fused to V5 and APEX2 - used for APEX2 proximity biotinylationDepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV18 [punc-47::SNG-1::CRY2olig(535)]
Plasmid#197598PurposeExpression of SNG-1::CRY2olig(535) in GABAergic motor neurons of C. elegansDepositorExpressionWormMutationE490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV12 [psng-1::SNG-1::CRY2olig(535)]
Plasmid#197596PurposePan-neuronal expression of SNG-1::CRY2olig(535) in neurons of C. elegansDepositorExpressionWormMutationE490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKM 1995
Plasmid#217826PurposeExpresses 1554 bp fragment of HY4 gene in A. thaliana. This HY4 fragment shows high homology to the phr genes in prokaryotes.DepositorAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only