We narrowed to 5,008 results for: AAT
-
Plasmid#89605PurposeSilencing Hmga2 in human cellsDepositorAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only
-
OR2M4_Deletion_gRNA
Plasmid#195194Purposedual gRNAs for deletion of OR2M4 in a third generation Cas9 backbone with GFPDepositorInsertOR2M4 dual gRNA (OR2M4 Human)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgSIK2
Plasmid#138708PurposeExpresses a human SIK2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_1
Plasmid#155059PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNcor1#2/Cre
Plasmid#173606PurposeExpresses a Ncor1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ncor1 (Ncor1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_3
Plasmid#155083PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PIK3CB gRNA (BRDN0001147768)
Plasmid#76194Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMY-Ly6G-Rluc_miR
Plasmid#163339PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a Ly6G surface markerDepositorAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
NTRK2 gRNA (BRDN0001148065)
Plasmid#76468Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCSF-R(dAB)-luc
Plasmid#12423DepositorInsertM-CSF receptor promoter fragment (CSF1 Human)
UseLuciferaseMutationNo AML1 and C/EBP binding sites (delete bp -86 to…Available SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
PBK gRNA (BRDN0001147308)
Plasmid#75574Purpose3rd generation lentiviral gRNA plasmid targeting human PBKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDR295
Plasmid#113874Purposeexpression of Cas9 programming sgRNA2 and sgRNA1 targetting GAL2 and HXT4-1-5/ HXT3-6-7 respectivelyDepositorInsertsgRNA2 GAL2 sgRNA1-HXT4-1-5;HXT3-6-7
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PKM gRNA (BRDN0001145396)
Plasmid#77633Purpose3rd generation lentiviral gRNA plasmid targeting human PKMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKM gRNA (BRDN0001162243)
Plasmid#77634Purpose3rd generation lentiviral gRNA plasmid targeting human PKMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crCoV-Mutiplex_EF1a-BFP
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only