We narrowed to 60,455 results for: Gene
-
Plasmid#63611Purposea binary Agrobacterium vector carrying the HSVtk gene as a negative selection marker against ectopic transformants.DepositorTypeEmpty backboneUseBinary fungal vectorPromoterLac PromoterAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pMC_mClover3_BSDminus_F0
Plasmid#184165PurposeDonor cassette plasmid for high-throughput tagging, encoding an mClover3 synthetic exon in frame 0, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmClover3
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-Z22
Plasmid#120065PurposeTemplate for C-terminal PCR tagging of mammalian genes (Zeocin selection) with SNAPDepositorInsertSNAP
UsePcr templateTagsSNAPPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-P15
Plasmid#120026PurposeTemplate for C-terminal PCR tagging of mammalian genes (Puromycin selection) with miRFP670DepositorInsertmiRFP670
UsePcr templateTagsmiRFP670PromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIMVAu1
Plasmid#98301PurposeEnhancing the upper-part mevalonate pathway; overexpressing codon-optimized Enterococcus faecalis mevalonate pathway genes under the control of galactose-inducible promoters; integrated into genome HMG2 locus; overexpressing HMG2 K6R.DepositorInsertHMG2(-309,-153)-HIS3-TEFM1ACS2>TACS2-PGAL2> EfmvaE >TEBS1-PGAL7>HMG2K6A(1,292)
ExpressionYeastAvailable SinceSept. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
-33 hTF
Plasmid#15453DepositorAvailable SinceJuly 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pJC005.gent
Plasmid#182739PurposeCRISPR-Cas12a genome editing of E. faeciumDepositorTypeEmpty backboneUseCRISPRAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-DR-SgRNA-DR-EF1a-mCherry-SV40
Plasmid#154002PurposeEmpty SgRNA expression system matching CasRxDepositorInsertSgRNA expression system
UseCRISPRPromoterU6, EF1aAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1D/mEGFP + CrPV IGR IRES-nLuc-3XFLAG-CL1PEST
Plasmid#127332PurposeExpress 3xFLAG tagged highly destabilized nanoLuciferase (nLuc) protein from CrPV IRESDepositorInsertnanoLuciferase
Tags3xFLAG and CL1/PESTExpressionMammalianPromoterCMVAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
SPL10p::pCGTAG (SPL10p::NLS-GFP)
Plasmid#27410DepositorInsertSPL10 promoter (AT1G27370 Mustard Weed)
MutationSPL10 promoter transcriptionally fused to a nucle…Available SinceFeb. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSPL10p::SPL10-GFP
Plasmid#27406DepositorAvailable SinceMarch 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
mOtop1_pcDNA3
Plasmid#114677PurposeThis construct was used to express mouse Otop1 in HEK-293 cellsDepositorInsertOtopetrin 1 (Otop1 Mouse)
ExpressionMammalianMutationSNP (rs49325632): Glycine 396 to AlaninePromoterCMVAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNBU2_erm_P1T_DP-GH023 - NanoLuc
Plasmid#117727PurposeIntegration vector at an attB site in Bacteroides; contains the P1T_DP aTC-inducible promoter with the RBS GH023 upstream of the NanoLuc reporterDepositorInsertNanoLuc
UseLuciferaseExpressionBacterialAvailable SinceDec. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-BICRAL-FLAG-pgk-puro
Plasmid#107732PurposeTet inducible lentiviral C-terminal FLAG BICRAL (GLTSCR1L) ORFDepositorAvailable SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-hygro-PAX9
Plasmid#75083Purpose[Edit] retroviral vector holding human PAX9 cDNADepositorInsertPAX9 (PAX9 Human)
UseRetroviralTagsnoneExpressionMammalianMutationfull length, wild type, without native 3' UTRAvailable SinceMay 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRR-AR
Plasmid#73045PurposeConstitutively expresses the androgen receptor, which is required for the activation of the promoter in pLAREG (Addgene plasmid #73045)DepositorInsertAndrogen receptor (AR Human)
ExpressionYeastMutationplease see depositor comments belowPromoterglyceraldehyde phosphate dehydrogenase (GPD)Available SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUC57-HBB-nLuc
Plasmid#175432PurposeUsed to generate IVT RNA for translation extractsDepositorInsertHBB-nLuc
UseLuciferaseExpressionBacterialPromoterT7Available SinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBEG R2-iCreT2ALuc-L3 #BGV208
Plasmid#48992PurposeSupplies Cre recombinase and Luciferase and IRES with flanked by AttR2 and AttL3 sites for Gateway cloning recombination reaction. (This corresponds to a module 3 plasmid).DepositorInsertscre recombinase
Luciferase
UseGateway Cloning and LuciferaseTagsIRES (weak)PromoterUnknownAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1-Gm129
Plasmid#53765Purposemammalian expression of EGFP-Gm129DepositorAvailable SinceSept. 5, 2014AvailabilityAcademic Institutions and Nonprofits only