We narrowed to 24,868 results for: ina
-
Plasmid#163477PurposeDirect-expressing iCre AAV Virus. Alias: AiP1045 - pAAV-AiE2010m-minBG-iCre-WPRE-HGHpADepositorInsertiCre
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AiP1036-pAAV-mscRE10-minBGpromoter-FlpO-WPRE-hGHpA
Plasmid#163473PurposeDirect-expressing FlpO AAV Virus. Alias: AiP1036 - pAAV-AiE2010m-minBG-FlpO-WPRE-HGHpADepositorInsertFlpO
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
EC71173
Plasmid#154061PurposeLevel 1, Position 2 Golden Gate vector. HspHv17::Cre-U5-CreDepositorInsertCre recombinase
ExpressionBacterialMutationIntroduction of U5 intron sequences, to prevent p…PromoterHvHSP17Available SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
C2-77 pComb3xss anti-cFos nanobody
Plasmid#145837PurposeBacterial expression of anti-cFos (Human) recombinant llama nanobody for use as an immunolabelDepositorInsertanti-cFos (Human) recombinant llama nanobody C2-77 (FOS L. glama (llama))
Tags6xHis-HAExpressionBacterialPromoterlacAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
C1-62 pComb3xss anti-cFos nanobody
Plasmid#145835PurposeBacterial expression of anti-cFos (Human) recombinant llama nanobody for use as an immunolabelDepositorInsertanti-cFos (Human) recombinant llama nanobody C1-62 (FOS L. glama (llama))
Tags6xHis-HAExpressionBacterialPromoterlacAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
C2-66 pComb3xss anti-cFos nanobody
Plasmid#145833PurposeBacterial expression of anti-cFos (Human) recombinant llama nanobody for use as an immunolabelDepositorInsertanti-cFos (Human) recombinant llama nanobody C2-66 (FOS L. glama (llama))
Tags6xHis-HAExpressionBacterialPromoterlacAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
C1-84 pComb3xss anti-cFos nanobody
Plasmid#145830PurposeBacterial expression of anti-cFos (Human) recombinant llama nanobody for use as an immunolabelDepositorInsertanti-cFos (Human) recombinant llama nanobody C1-84 (FOS L. glama (llama))
Tags6xHis-HAExpressionBacterialPromoterlacAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk12_Untagged
Plasmid#127176PurposeUntagged mouse Cdk12 transgene (NM_001109626.1 isoform) cloned into Gateway entry vectorDepositorInsertMouse Cyclin Dependent Kinase 12 (Cdk12 Mouse)
UseEntry vector with transgene for gateway cloningTagsNonePromoterNoneAvailable SinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
SHIP2 WT pBABE-His-Xpress
Plasmid#126584PurposeRetroviral infection of MEF cells (puromycin selection)DepositorAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/FLAGHA-SCAF8
Plasmid#122470PurposeDox-inducible FLAG/HA (N-terminal tag) SCAF8 expressionDepositorInsertSCAF8 isoform C CRISPR resistant (SCAF8 Human)
TagsFLAGHAExpressionMammalianMutationSynonymous mutations conferring resistance to gRN…PromoterCMVAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DCX-2A-mCherry
Plasmid#118290PurposeExpresses human DCX tagged with 2A peptide at it's C-terminus and mCherry in mammalian cells.DepositorInsertdoublecortin (DCX Human)
UseAAVTags2A peptide and mCherryExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
coreR1 (384-1008)
Plasmid#115646Purposeexpression of truncated Rag1DepositorInsertRag1 core (384-1008) (Rag1 Mouse)
Tags8XHis-MBP-PreScissionExpressionMammalianMutationtruncated Rag1 (aa 384-1008)Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG ID2
Plasmid#98390PurposeGateway entry vector for inducible expression of human ID2 with N-terminal 3xFLAG tagDepositorAvailable SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
EPHB1_HUMAN_D0
Plasmid#79694PurposeThis plasmid encodes the kinase domain of EPHB1. Intended for co-expression with YopH Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB120
Plasmid#68574PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ntn5.a-Fc-His
Plasmid#72107PurposeExpresses the entire Netrin 5, isoform a protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema4g-Fc-His
Plasmid#72160PurposeExpresses the extracellular region of the Sema4G protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sema3e(L)-Fc-His
Plasmid#72145PurposeExpresses the Sema3E protein (truncated at cleavage site P3; ie, long), C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-Flag-H2A K5-9R
Plasmid#63562PurposeExpression of human H2A with K5R and K9R tagged with FlagDepositorInsertH2A (H2AC20 Human)
TagsFlag (MDYKDDDDKVPRIQ)ExpressionMammalianMutationLysine 5 and Lysine 9 are now ArgininePromoterCMVAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only