We narrowed to 17,356 results for: sequence
-
Plasmid#21919DepositorInsertMutant huamn HKI (with a mutation in the catalytic site in the C-terminal half of the enzyme) in pGFP-N3 (HK1 Human)
TagsGFPExpressionMammalianMutationThis is the full length human HKI cDNA sequence w…Available SinceNov. 2, 2009AvailabilityAcademic Institutions and Nonprofits only -
Plxna3-Fc-His
Plasmid#72124PurposeExpresses the extracellular region of the PlexinA3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
mMib1-FLAG
Plasmid#37116DepositorInsertMib1(Mus musculus mindbomb homolog 1 (Drosophila) (Mib1)) (Mib1 Mouse)
Tags3 x FLAGExpressionMammalianMutationACC Kozak sequence added before ATG annotated.PromoterCMVAvailable SinceJuly 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLenti-BE4GamRA-P2A-Puro
Plasmid#112673PurposeLentivirus for constitutive expression of BE4GamRA in mammalian cells (codon optimized)DepositorInsertBE4GamRA
UseLentiviralTagsFLAGMutationNLS sequence at the N-terminus and D10APromoterEF1sAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
proE-cad178-Luc-mEbox
Plasmid#42082DepositorInsertE-cadherin (CDH1 Human)
UseLuciferaseExpressionMammalianMutationcontains E-cadherin promoter region from -178 to …PromoterE-cadherinAvailable SinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
GFP-WT (AF41)
Plasmid#21367DepositorInsertautosomal dominant polycystic kidney disease type I (PKD1 Human)
TagsEGFP and FLAGExpressionMammalianMutationwild-type sequence*Available SinceDec. 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
pFastbac1-GST-hUSP7
Plasmid#63573PurposeExpression of synthetic human USP7 tagged with GSTDepositorInsertUSP7 (USP7 Human, Synthetic)
TagsGSTExpressionInsectMutationSynthetic based on human protein sequence (please…PromoterPolyhedrinAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
Plxnd1-Fc-His
Plasmid#72132PurposeExpresses the extracellular region of the PlexinD1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-LpIA(wild-type)
Plasmid#61821PurposeEncodes a wild-type sequence of LplA and serves as the negative control for resorufin labelingDepositorInsertE. coli lipoic acid ligase
Tags6XHis, EGFP, and FlagExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-HLA-cmyc-natT1R2
Plasmid#113946Purposemammalian expression plasmid for c-myc-tagged human T1R2 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R2 (TAS1R2 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 22-839Available SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTT3 Flrt1-myc
Plasmid#72191PurposeExpress full-length Flrt1 with a C-terminal myc tagDepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-GRM3-VN
Plasmid#98965PurposeFLAG-tagged human mGluR3 fused to N-terminus of split VenusDepositorInsertGRM3 (GRM3 Human)
TagsFLAG (dykddddk) epitope tag, Signal/leader sequen…ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Chicken Mermaid S188
Plasmid#53617PurposeGenetically encoded voltage sensor based on mUKG-mKOk FRET pairDepositorInsertChicken Mermaid S188
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(L)-AP-His
Plasmid#72039PurposeExpresses the extracellular region of the Sema6B protein (entire extracellular domain; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
TrHKI-pGFPN3
Plasmid#21918DepositorInsertTruncated human HKI (lacking exon 1 sequence that encodes for the mitochondrial binding domain) in pGFP-N3 plasmid (HK1 Human)
TagsGFPExpressionMammalianMutationThis is the truncated human HKI cDNA (lacking exo…Available SinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(S)-AP-His
Plasmid#72040PurposeExpresses the extracellular region of the Sema6B protein (truncated at extracellular domain cleavage site; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 ECD-MHC
Plasmid#113957Purposemammalian expression plasmid for FLAG-tagged human T1R2 ECD with signal peptide of influenza hemagglutinin fused to a canonical transmembrane domain from MHC class IDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG, Signal/leader sequence from influenza hemag…ExpressionMammalianMutationresidues 22-568 fused to a transmembrane tetherPromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only