We narrowed to 1,489 results for: ARAB-1
-
Plasmid Kit#1000000145PurposeUbiGate E2 Activity Screen (set 2) includes expression cassettes containing ubiquitin, the E1 UBA1 in combination with all Arabidopsis thaliana E2's for E3 autoubiquitination assays. See Kit #1000000144 for Set 1 components.DepositorApplicationCloning and Synthetic BiologyVector TypeBacterial ExpressionCloning TypeGolden GateAvailable SinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pSLTS
Plasmid#59386PurposeExpresses the lambda Red recombinase under control of the arabinose-inducible P(araB) promoter and I-SceI under control of the anhydrotetracycline-inducible P(tetA) promoter.DepositorTypeEmpty backboneUseGenome engineeringExpressionBacterialAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
BLIM cells
Bacterial Strain#35609DepositorBacterial ResistanceNoneAvailable SinceJune 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
MBP-CRY1-PHR
Plasmid#26035DepositorAvailable SinceDec. 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
pENTR4 CDS A. thaliana PARP1
Plasmid#175818PurposepENTR4 plasmid with CDS of Arabidopsis thaliana POLY(ADP-RIBOSE) POLYMERASE 1 (PARP1, AT2G31320.1) without stop codon for C-terminal epitope tagsDepositorInsertPARP1 (PARP1 Mustard Weed)
UsePentr plasmid for gateway cloningTagsnoneMutationone silent mutation, annotated in GenBank filePromoternoneAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDDGFP2_leu2d_NRT1.1
Plasmid#58332PurposeExpresses Arabidopsis thaliana NRT1.1 in Saccharomyces cells as a C-terminal GFP his tagged proteinDepositorAvailable SinceAug. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 CDS A. thaliana PHOT1
Plasmid#209187PurposepENTR4 plasmid with CDS of Arabidopsis thaliana PHOTOTROPIN 1 (PHOT1, AT3G45780.1) without stop codon for C-terminal epitope tagsDepositorAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pICSL11015
Plasmid#117499PurposeFAST-Red selectable marker Golden Gate Level 1 Position 1DepositorInsertBpiI:TGCC:pOLE1:OLE1-RFP:OLE1t:GCAA:BpiI
TagsRFPExpressionPlantPromoterAtOLE1Available SinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pETDuet-AtRBX1-T7-AtSKP1-T7-AtCUL1-S
Plasmid#238003PurposeExpression AtRBX1-T7, AtSKP1-T7 and AtCUL1-S in in bacterial cellsDepositorTagsS and T7ExpressionBacterialAvailable SinceJune 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-v2 RsTAL At4CL
Plasmid#126524Purposeexpresses TAL (Rhodobacter sphaeroides) and 4CL (Arabidopsis thaliana paralog 1) for PYP chromophore biosynthesisDepositorInsertsTagsHisExpressionBacterialPromoterT7Available SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AtSLAC1 WT
Plasmid#212946PurposeVector used for expression of AtSLAC1 WT in mammalian cellDepositorAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-N-PAS2-GAF-PHYB-MCherry-CAAX
Plasmid#154910Purpose1-621 amino acids of Arabidopsis PHYB (Gene ID: 816394), tagged with mCherry fluorescence protein and the CAAX membrane moiety. Mammalian codon optimised.DepositorInsertPhytochrome B (PHYB Mustard Weed, Synthetic)
UseXenopus/avian/zebrafishTagsCAAX membrane moiety and mCherryExpressionMammalianMutation1-621 amino acids of Arabidopsis PHYBPromoterCMVAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+-Y276H PHYB-CAAX
Plasmid#154911Purpose1-621 amino acids of Arabidopsis PHYB (as in construct Addgene ID 154910) with the CAAX membrane moiety tag. Tyrosine residue 276 of PHYB was mutated to Histidine.DepositorInsertPhytochrome B (PHYB Mustard Weed)
UseXenopus/avian/zebrafishTagsCAAX membrane moiety and mCherryExpressionMammalianMutation1-621 amino acids of Arabidopsis PHYB, Tyrosine r…PromoterCMVAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.1-AtSLAC1 6D
Plasmid#212947PurposeVector used for expression of AtSLAC1 6D in mammalian cellDepositorInsertSlow anion channel-associated 1 (OZS1 Mustard Weed)
ExpressionMammalianMutationT62D/S65D/S107D/S124D/S146D/S152DPromoterCMVAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AtSLAC1 8D
Plasmid#212948PurposeVector used for expression of AtSLAC1 8D in mammalian cellDepositorInsertSlow anion channel-associated 1 (OZS1 Mustard Weed)
ExpressionMammalianMutationS59D/T62D/S65D/S86D/S107D/S124D/S146D/S152DPromoterCMVAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only