We narrowed to 157 results for: Synechococcus
-
Plasmid#119800PurposeRpoD5 epitope tagged construct for integration at neutral site 2.2DepositorInsertSynpcc7942_1849 (Synpcc7942_1849 )
ExpressionBacterialAvailable SinceDec. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACSA_PcptOO_YFP_PMB2__LacIWF
Plasmid#82020PurposecLac94; pALM94; IPTG inducible systemDepositorInsertYFP
PromoterPcptooAvailable SinceOct. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSW036
Plasmid#140034PurposeKO of PCC 11901 acsA gene/expresses YFP under control of the cpt promoterDepositorInsertYellow fluorescent protein
ExpressionBacterialPromotercptAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
PBAD-his6-prkA-pACYC184
Plasmid#41041DepositorInsertprkA
Tags6xHis and T7 epitope tagExpressionBacterialPromoterPBADAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pC0.423
Plasmid#203947PurposeLevel 0 part. 2,4-diacetylphloroglucinol (DAPG)-inducible phlF_PphlF promoter.DepositorInsertphlF-PphlF
UseSynthetic BiologyAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC1.509
Plasmid#203955PurposeLevel 1 self-replicating vector containing a DAPG inducible FnCas12aDepositorInsertPphlF-Cpf1
UseSynthetic BiologyAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
rbcLS-pMAL-2px
Plasmid#41621DepositorInsertrbcL/rbcS
ExpressionBacterialPromoterPtacAvailable SinceNov. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSW039
Plasmid#140035PurposeKO of PCC 11901 psbA2 gene/expresses YFP under control of inducible cLac143 promoterDepositorInsertYellow fluorescent protein
ExpressionBacterialPromotercLac143Available SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSW071
Plasmid#140037PurposePCC 11901 fadD locus KO with a kanamycin resistance cassetteDepositorInsertKanamycin resistance gene
UseGene knockout in cyanobacteriaPromoterKanRAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCA0.421
Plasmid#203950PurposeLevel 0 acceptor vector for assembling gRNA arrays for Cas12a in SP positionDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGCG26
Plasmid#82371PurposeYFP expressed from pJ23119 in the glpK locus with gentamicin resistanceDepositorInsertYFP
PromoterPJ23119Available SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pALM179
Plasmid#82023Purposean updated version of cLac143 (pACSA_PcptOO_C38T,A39T_YFP_PMB2_LacIWF). The homologous region upstream of the inducible system was fixed to add a stop codon for A1837. No difference in expressionDepositorInsertYFP
Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas49
Plasmid#82391PurposerbcL-sfGFP expressed from PccmK2 promoter with Gmr in glpKDepositorInsertrbcL-GFP
PromoterPccmK2Available SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET41-GST-KaiC
Plasmid#68051PurposeStrain: AM5117, Used for protein purificationDepositorInsertKaiC
Tags6xHis, GST, and S-TagExpressionBacterialPromoterT7Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28-SUMO-KaiB
Plasmid#68050PurposeStrain: AM5116, Used for protein purificationDepositorInsertKaiB
Tags6xHis and SUMOExpressionBacterialPromoterT7Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28-SUMO-KaiA
Plasmid#68049PurposeStrain: AM5115, Used for protein purificationDepositorInsertKaiA
Tags6xHis and SUMOExpressionBacterialPromoterT7Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCcmO-StrepII-PDT
Plasmid#165584PurposeNative CcmO fusion with a StrepII tag and PDTDepositorInsertCcmO-PDT
TagsProtein degradation tagExpressionBacterialAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pALM174
Plasmid#82022Purposean updated version of cLac94 (pACSA_PcptOO_YFP_PMB2__LacIWF). The homologous region upstream of the inducible system was fixed to add a stop codon for A1837. No difference in expressionDepositorInsertYFP
PromoterPcptooAvailable SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMK83
Plasmid#226793PurposeIntegrates slr0214 (HIP1 methyltransferase) into gidB-atpI locus of E. coli DH10BDepositorInsertslr0214 (slr0214 Synechocystis sp. PCC 6803)
ExpressionBacterialPromoterTetracycline resistance cassette promoter (constiā¦Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only