We narrowed to 109 results for: dCas9-VPR
-
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pCRI006-pYFAC-riboB-PgpdA-dSpCas9-VPR-TtrpC
Plasmid#140199PurposeEpisomal expression of dSpCas9-VPR. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdSpCas9-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSPromoterPgpdAAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
Plasmid#140196PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.DepositorInsertsdSpCas9-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta) , NLSPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgMyo7b-CMV-5’dCas9-SDS-BD10-SV40pA
Plasmid#216322PurposeTransactivation of murine Myo7b gene via split dCas9-VPR (REVeRT system).DepositorInsertSplit Cas9-VPR + splice donor site + gRNAs targeting the murine Myo7b locus for transactivation
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB_p300_core-dCas9-EGFP_hygro
Plasmid#226431PurposePiggyBac transposon vector containing a dox inducible p300 core-dCas9 fusion protein and EGFP reporter. Hygromycin selection markerDepositorInsertsp300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, P2A-EGFP, and p300 coreExpressionMammalianPromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-sadCas9-VP64
Plasmid#115790PurposeAn AAV vector expressing S. aureus dCas9 fused to VP64.DepositorInsertSa-dCas9
UseAAVTagsNLS and NLS-VP64ExpressionMammalianPromoterCMVAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-3xsgRNA_Opn1mw-RHO-Cas9N-IntN-polyA
Plasmid#165450PurposeExpress N-terminal part of split dCas9-VPR and 3 sgRNAs targeting murine Opn1mw promoterDepositorInsertsdCas9N-IntN
3x Opn1mw promoter-targeting sgRNAs
UseAAV and CRISPRExpressionMammalianPromoterU6 and short human rhodopsin promoterAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
OA-986B
Plasmid#124999PurposeExpresses dCas9-VPR driven by the Ubiquitin-63E promoterDepositorInsertdCas9-VPR
UsePiggybackExpressionInsectPromoterUbiquitinAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSC-pGAL10-CRISPRa
Plasmid#240210PurposeYeast vector for integration of pGAL10-dCas9 and pGAL10-MCP-VPR at LEU2 locusDepositorInsertsMCP-VPR
dCas9
ExpressionYeastPromoterpGAL10Available SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
OA-986C
Plasmid#125000PurposeExpresses dCas9-VPR driven by the bottleneck promoterDepositorInsertdCas9-VPR
UsePiggybackExpressionInsectPromoterbottleneckAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEDJ-87
Plasmid#163085PurposeMarkerFree plasmid for integration of pADH1-MCP-VPR into site XI-5DepositorInsertVPR
TagsMCPExpressionYeastPromoterADH1Available SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT076
Plasmid#137880PurposeDonor vector for integration at the human AAVS1 safe harbor locus of Doxicycline-inducible dCas9-VPR-T2A-EGFPDepositorInsertTRE3G-dCas9-VPR-T2A-EGFP-CAG-TetON-NeoR-SA
UseAAVExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
JEH127
Plasmid#179299PurposeExpresses dCas9 fused to VPRDepositorInsertdCas9-VPR
ExpressionMammalianMutationD10A, H840A (catalytically inactive Cas9)PromoterCAGAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_120
Plasmid#96917Purposefor CRISPRa, lentiviral expression of dCas9-VPR 2A BlastRDepositorInsertdCas9
UseLentiviralTagsVPRExpressionMammalianMutationD10A, N863APromoterEF1aAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
GWF180
Plasmid#133607PurposeCAG-DNCR2-VPR-IRES-Puro-WPRE-SV40PA-PGK-NS3aH1-tagBFP-SpdCas9DepositorInsertDNCR2-VPR, NS3aH1-tagBFP-SpdCas9
ExpressionMammalianAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
ARB367
Plasmid#124050PurposeEncodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to VPR domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vectorDepositorInsertPB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::VPR-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
GB4068
Plasmid#187810PurposeModule for the constitutive expression of Cup2:Gal4AD and copper-inducible expression of dCasEV2.1 (dCas9:EDLL and MS2:VPR).DepositorInsertcopper-inducible dCasEV2.1
ExpressionPlantAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only