Skip to main content

We narrowed to 107 results for: dCas9-VPR

Showing: 81 - 100 of 107 results
  1. pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1

    Plasmid
    #99690
    Purpose
    Expresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAV
    Depositor
    Insert
    dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
    Use
    AAV and CRISPR
    Tags
    VPR mini
    Mutation
    dead Cas9
    Available Since
    Sept. 12, 2018
    Availability
    Academic Institutions and Nonprofits only
  2. pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2

    Plasmid
    #99694
    Purpose
    Expresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAV
    Depositor
    Insert
    dCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
    Use
    AAV and CRISPR
    Tags
    VPR mini
    Mutation
    dead Cas9
    Available Since
    Jan. 16, 2020
    Availability
    Academic Institutions and Nonprofits only
  3. pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS

    Plasmid
    #140196
    Purpose
    Chromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.
    Depositor
    Inserts
    dSpCas9-VPR
    Bar
    Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
    Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
    Use
    CRISPR and Synthetic Biology; Fungal genome integ…
    Tags
    VPR (VP64-p65-Rta) , NLS
    Promoter
    PgpdA and PtrpC
    Available Since
    Sept. 11, 2020
    Availability
    Academic Institutions and Nonprofits only
  4. PB_p300_core-dCas9-EGFP_hygro

    Plasmid
    #226431
    Purpose
    PiggyBac transposon vector containing a dox inducible p300 core-dCas9 fusion protein and EGFP reporter. Hygromycin selection marker
    Depositor
    Inserts
    p300 core-dCas9-EGFP fusion protein
    rtTA3-IRES-Hygro
    Use
    CRISPR and Synthetic Biology; Piggybac transposon
    Tags
    HA tag, P2A-EGFP, and p300 core
    Expression
    Mammalian
    Promoter
    Dox inducible minimal CMV and UbC Promoter
    Available Since
    Sept. 10, 2025
    Availability
    Academic Institutions and Nonprofits only
  5. PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro

    Plasmid
    #226427
    Purpose
    PiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.
    Depositor
    Inserts
    Mutant p300 core-dCas9-EGFP fusion protein
    rtTA3-IRES-Hygro
    Use
    CRISPR and Synthetic Biology; Piggybac transposon
    Tags
    HA tag, Mutant p300 core, and P2A-EGFP
    Expression
    Mammalian
    Mutation
    p300 core mutation (D1399Y)
    Promoter
    Dox inducible minimal CMV and UbC Promoter
    Available Since
    Sept. 10, 2025
    Availability
    Academic Institutions and Nonprofits only
  6. ARB367

    Plasmid
    #124050
    Purpose
    Encodes pEF1a driving expression of TET3G P2A iRFP713, pEF1a expressing sadCas9 fused to VPR domain P2A mRuby2, and an sgRNA targeting pUAS expressing mAzamiGreen in a PiggyBac destination vector
    Depositor
    Insert
    PB_pEF1a-tet3G-P2A-iRFP713_pEF1a-sadCAS9::VPR-P2A-mRuby2-SV40PA_mu6-sgUAS_pUAS-NLS::mAzamiGreen-rgPA
    Expression
    Mammalian
    Available Since
    Dec. 13, 2019
    Availability
    Academic Institutions and Nonprofits only
Showing: 81 - 100 of 107 results