We narrowed to 31,839 results for: GRN;
-
Plasmid#169450Purposebackbone for sgRNA expressionDepositorInsertsgRNA
UseLentiviralAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #1 GFP
Plasmid#106950PurposeLentivirus encoding sgRNA targeting murine Notch1. Includes GFP marker.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2ABFP-W
Plasmid#67985PurposeCas9 activity reporter (control) with mCherry and BFPDepositorInsertU6gRNA cassette, PGKmCherryABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK1/HRI_sgRNA
Plasmid#218529PurposesgRNA targeting human EIF2AK1/HRIDepositorInsertEIF2AK1 (EIF2AK1 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Hic1 GFP
Plasmid#106953PurposeLentivirus encoding sgRNA targeting murine Hic1. Includes GFP marker.DepositorInsertanti-Hic1 sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g3)-PGKpuroBFP-W
Plasmid#211984PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_epegRNA_entry-mpknot_(LM1140)
Plasmid#228253PurposepU6 entry plamid for cloning prime editor mpknot epegRNAs (requires BsmBI or Esp3I digest and ligation of duplexed oligos)DepositorInsertmpknot entry plasmid backbone for epegRNA expression via human U6 promoter
ExpressionMammalianMutationn/aPromoterU6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1 double gRNAs
Plasmid#162791PurposeMultiplex Guide RNAs to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
HH-gRNA-HDV-Shuttle-Vector
Plasmid#169098PurposeBackbone plasmid to generate HH-gRNA-HDV segmentDepositorInsertHH-gRNAbackbone-HDV
ExpressionMammalianPromoterNAAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP
Plasmid#67991PurposeCRISPR gRNA expression vector with an improved l scaffold and puro/BFP markers without WPREDepositorInsertU6gRNA cassette with an improved scaffold, PGKpuro2ABFP cassette
UseCRISPR and LentiviralAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-AAVS1_sgRNA
Plasmid#183890PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and sgRNA targeting the AAVS1 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-U6-sgRNA-BFP-Puro
Plasmid#229014PurposePerturb Seq lentiviral sgRNA vectorDepositorTypeEmpty backboneUseLentiviralAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA-Sirius-8XMS2
Plasmid#121939PurposeCRISPR-Sirius plasmidDepositorInsertsgRNA-Sirius-8XMS2
UseCRISPR and LentiviralTagsnoExpressionMammalianPromoterhuman U6 promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AmAG-W
Plasmid#67976PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mAG markersDepositorInsertU6gRNA cassette, PGKpuro2AmAG cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-TGM2
Plasmid#69239PurposeU6 driven SpCas9 sgRNA expression for TGM2 siteDepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-8x-gRNA-eGFP
Plasmid#60718PurposeeGFP reporter containing 8 copies of a gRNA binding site for light-inducible dCas9 activationDepositorInsert8 copies of gRNA binding site (5'-AAAGGTCGAGAAACTGCAAA-3')
Available SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6-AsCas12f-full-length-sgRNA
Plasmid#204638PurposeExpression of full-length AsCas12f sgRNA in mammalian cellsDepositorInsertfull-length AsCas12f sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA-lib 2.0
Plasmid#89638PurposesgRNA expression in mammalian cells after Gateway cloningDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterhU6Available SinceFeb. 16, 2018AvailabilityAcademic Institutions and Nonprofits only