We narrowed to 13,955 results for: CRISPR-Cas9
-
Plasmid#112393PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor HEY1DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pJW1219
Plasmid#61250PurposeCRISPR/Cas9 plasmid containing sgRNA(F+E); for use in C. elegansDepositorInsertsgRNA(F+E)
UseCRISPRExpressionWormPromoterU6 promoterAvailable SinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJW1285
Plasmid#61252PurposeCRISPR/Cas9 plasmid with sgRNA(F+E) targeting pha-1; for co-conversion in C. elegansDepositorInsertsgRNA(F+E) targeting pha-1
UseCRISPRExpressionWormAvailable SinceDec. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pARNTL.1.0-gDNA
Plasmid#112480PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ARNTLDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2C.1.0-gDNA
Plasmid#113792PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFAP2CDepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDDIT3.1.0-gDNA
Plasmid#112396PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor DDIT3DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPtGE35
Plasmid#107999PurposeExpresses TevCas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
I-TevI nuclease and partial linker domain
UseCRISPR and Synthetic Biology; Episomal vector for…TagsCas9Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CR102
Plasmid#234043Purposeexpresses ABE8e(V106W) - SpG Cas9 base editor in a human T cell optimized lentiviral transfer plasmidDepositorInsertTadA8e(V106W)-SpG-Cas9(D10A)-P2A-blast
UseLentiviralAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
SpRYc
Plasmid#175575PurposeExpresses the codon-optimized, engineered SpRYc Cas9 nuclease in mammalian cellsDepositorInsertSpRYc
TagsEGFPExpressionMammalianMutationPID of SpRY grafted onto the N-terminal domain of…PromoterCMVAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-Puro
Plasmid#171992PurposeDelivers all prime editing nuclease components in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-Puro, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-GFP
Plasmid#171994PurposeDelivers all prime editing nuclease components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
AID-C12*-BE4max
Plasmid#216729PurposeExpresses a BE4max base editing construct comprised of the hyperactive AID-C12* and nCas9 (Cas9 with D10A mutation) in mammalian cells.DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTB106-Hyg
Plasmid#236779PurposeExpression of Cas9 cytosine base editor (CBE), T7 RNAP, Cas12a and hygromycin selection marker. The CBE contains a ssDNA-DBD from the L. major RAD51 protein. This plasmid is transfected as episome.DepositorInserthyBE4max (CBE); Cas12a (Acidaminococcus sp. BV3L6)-P2A-T7 RNAP
UseCRISPRAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTB107-Phleo
Plasmid#236782PurposeExpression of Cas9 cytosine base editor (CBE), T7 RNAP, Cas12a and phleomycin selection marker. The CBE contains a ssDNA-DBD from the H. sapiens RAD51 protein. This plasmid is transfected as episome.DepositorInserthyBE4max (CBE); Cas12a (Acidaminococcus sp. BV3L6)-P2A-T7 RNAP
UseCRISPRAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGECPL.BC10.MG
Plasmid#223822PurposeContains Cas9-editable barcode, marking guide (MG) for lineage tracing, Cre for Cas9 activation and loxP-mediated gene deletion, and Firefly Luciferase (FLuc) for live luminescence-based monitoring.DepositorInsertEf1a-Driven Cre-P2A-FLuc
UseCRISPR, Cre/Lox, Lentiviral, Luciferase, and Mous…TagsP2AExpressionMammalianPromoterEf1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRCT
Plasmid#60621PurposePlasmid encoding iCas9, tracrRNA and crRNAsDepositorInsertsiCas9
tracrRNA
UseCRISPRTagsFLAG and SV40 NLSExpressionYeastMutationchanged Aspartate 147 to Tyrosine, Proline 411 to…PromoterRPR1p and TEF1pAvailable SinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET-MBP-NLS-Geo_st
Plasmid#87703PurposeExpression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBP and SV40 NLSDepositorInsertGeoCas9
Tags10xHis-MBP-TEVExpressionBacterialAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only