We narrowed to 37,610 results for: ELL
-
Plasmid#216248PurposeHDR template to tag endogenous human RANGAP1 C-terminus with miniIAA7.3xFlag.P2A.BSDDepositorPublicationInsertHDR template for human RANGAP1 (RANGAP1 Human)
UseCRISPR and TALEN; Hdr templateTagsminiIAA7.3xFlag.P2A.BSDExpressionMammalianAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 blast tBID-flag
Plasmid#211533PurposeExpresses truncated BID upon doxycycline addition to trigger apoptosisDepositorInserttBID-flag (BID Human)
UseRetroviralTagsFLAGExpressionMammalianMutationTruncated (CASP8) form (p15)Available sinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG J591-scFV T-CAR
Plasmid#171961PurposeDonor plasmid for J591 T-CAR expression in human cellsDepositorInsertSynthetic J591-scFV CAR
UseCRISPR, Synthetic Biology, and TALENExpressionMammalianPromoterCAGAvailable sinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable sinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
(318) pcDNA3.1-myc-OGA(1-400)D174N
Plasmid#168096PurposeMyc tagged inactive truncated human OGA catalytic domain of residues 1-400 with D174N mutationDepositorInsertmyc-OGA(1-400, D174N)
TagsmycExpressionMammalianMutationD174N catalytically inactive OGAPromoterT7/CMVAvailable sinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CD9-(TEV)-tTA
Plasmid#162596Purposehuman CD9-TEV cleavage site-tTADepositorInserthuman CD9 (CD9 Human)
TagsTEV protease cleavage site and tTAExpressionMammalianPromoterCMV promoterAvailable sinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-dEsCas13d-EGFP-NLS-3xFlag
Plasmid#132410Purposeoverexpression in human cellsDepositorInsertdEsCas13b
UseLentiviralTagsflagExpressionMammalianMutationR295A; H300A; R849A; H854AAvailable sinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN440
Plasmid#137874PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRa; mRFP-T2A-BlasticidinRDepositorAvailable sinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-His:PYL1:nls:VPR
Plasmid#135988PurposeExpresses the PYL1 abscisic acid-inducible domain fused to the VPR transcriptional activation domain in mammalian cellsDepositorInsertPYL1 domain fused to the VPR activation domain
TagsHisExpressionMammalianPromoterCMVAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_AURKB
Plasmid#111682PurposeMAC-tagged gene expressionDepositorInsertAURKB (AURKB Human)
ExpressionMammalianAvailable sinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NL-BCL2L1
Plasmid#113458PurposeNanoLuc-BCL2L1 expression vector (positive control together with pcDNA3.1 PA-mCit-BAD)DepositorInsertBCL2 like 1 (BCL2L1 Human)
UseLuciferaseTagscmyc-NanoLucExpressionMammalianPromoterCMVAvailable sinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC57-4eCOL2A1
Plasmid#97211PurposeFor cloning of a COL2A1-based, chondrogenesis-responsive promoter, and subcloning this insert into new vectorsDepositorInsert4 repeats of COL2A1 intronic enhancer (+2126/+2174) upstream of core promoter (-164/+37) (COL2A1 Human)
UseVector is designed for cloning and generation of …PromoterCOL2A1 regulatory elementsAvailable sinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cav3P104L-YFP
Plasmid#68404PurposeExpression of fluorescently tagged Caveolin3 point mutation in mammalian cellsDepositorInsertCav3 (Cav3 Mouse)
TagsEYFPExpressionMammalianMutationProline at position 104 changed to a LeucinePromoterCMVAvailable sinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 AT1R DRY-AAY
Plasmid#45759DepositorInsertAT1R DRY-AAY (Agtr1a Rat)
TagsHAExpressionMammalianMutationchanged amino acids 125-126 from DR to AAPromoterCMVAvailable sinceJuly 2, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AiP14360: pAAV-AiE0779m_3xC2-minBG-jGCaMP8s-WPRE3-BGHpA (Alias: CN4360) (AAV PHP.eB)
Viral prep#214856-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from AiP14360: pAAV-AiE0779m_3xC2-minBG-jGCaMP8s-WPRE3-BGHpA (Alias: CN4360) (#214856). In addition to the viral particles, you will also receive purified AiP14360: pAAV-AiE0779m_3xC2-minBG-jGCaMP8s-WPRE3-BGHpA (Alias: CN4360) plasmid DNA. minBG-driven expression of jGCaMP8s in striatal direct pathway medium spiny neurons (D1 MSNs). These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C EGFR EABR
Plasmid#234994PurposeFor production of Extracellular Vesicles (EVs), with Epithelial Growth Factor Receptor on their surface, Strep-tag II labeled on its N-terminusDepositorAvailable sinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3-SEC61B.N-BSD.P2A.miniIAA7.3xFlag
Plasmid#216250PurposeHDR template to tag endogenous human SEC61B N-terminus with BSD.P2A.miniIAA7.3xFlagDepositorPublicationInsertHDR template for human SEC61B (SEC61B Synthetic, HDR template, Human)
UseCRISPR; Hdr templateTagsBSD.P2A.miniIAA7.3xFlagExpressionMammalianAvailable sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-DDR1-V5/HIS
Plasmid#201100Purposeexpression of human DDR1 receptor tyrosine kinase in mammalian cellsDepositorInserthuman DDR1 receptor tyrosine kinase, full length, wildtype (DDR1 Human)
TagsV5/HisExpressionMammalianPromoterCMVAvailable sinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBK086
Plasmid#183145PurposepET-6xHis-MBP-TEV-MapTIR-APAZ/MapAgo - Heterolgous MapSPARTA expressionDepositorInsertMapSPARTA operon (6xHis-MBP-MapTIR-APAZ and MapAgo)
Tags6xHis and MBPExpressionBacterialPromoterT7Available sinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEF1a-hMLH1dn (og codon)
Plasmid#174823PurposeMammalian expression of human MLH1dn (original codon usage)DepositorInserthuman MLH1dn (original codon usage) (MLH1 Human)
ExpressionMammalianMutationdeletion of residues 754-756PromoterEF1aAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by