We narrowed to 12,232 results for: 110
-
Plasmid#65402PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only
-
Nrp2.1-Fc-His
Plasmid#72098PurposeExpresses the extracellular region of the Neuropilin 2, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSG5-HA-p300-DY1399
Plasmid#89095Purposemammalian expression of full-length human p300 with DY1399 mutation, acetylation mutant, acetyltransferase activity defectDepositorInsertp300-D1399Y mutant (EP300 Human)
TagsHAExpressionMammalianMutationp300-DY1399PromoterSV40Available SinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-SP140
Plasmid#65394PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-hGLIS1
Plasmid#37625PurposeNon-integrating (episomal) expression of human GLIS1DepositorAvailable SinceDec. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
Sox2-t2A-GFP
Plasmid#127537PurposeExpresses human SOX2 and eGFP via t2A linker.DepositorAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-TRIM28
Plasmid#45568DepositorInsertTRIM28 (TRIM28 Human)
TagsEGFPExpressionMammalianMutationG34S mutation in EGFPPromoterCMVAvailable SinceMay 29, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMGS46 (ARF16-PB1-HA-P2A-OsTIR1)
Plasmid#126580PurposeA repair construct to express ARF16-PB1-HA and OsTIR1 under the control of the CMV promoter from the human AAVS1 locusDepositorInsertOsARF16-PB1 domain
TagsHAExpressionMammalianAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-FAM208A ts3
Plasmid#115873PurposeFAM208a knockdownDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-FAM208A ts1
Plasmid#115871PurposeFAM208a knockdownDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
ITPKA-mTurquoise2
Plasmid#137811PurposeIn vivo visualization of actin cytoskeleton (can be used for colocalization studies)DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 HA-FAM208A
Plasmid#115845PurposeEncodes codon optimized HA tagged FAM208ADepositorAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/MPL-HA
Plasmid#204530PurposeMammalian expression of human MPL-HADepositorInsertMPL-HA (MPL Human)
ExpressionMammalianAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-Scal-T2A-EGFP-Puro
Plasmid#234949PurposeDoxycycline-inducible mitochondria-localized ScaI expressing plasmidDepositorInsertScaI restriction enzyme with N-terminal COX8 mitochondrial localization signal
UseLentiviralTagsFLAGExpressionMammalianPromotertight TRE promoterAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-ApaLI-T2A-EGFP-Puro
Plasmid#234948PurposeDoxycycline-inducible mitochondria-localized ApaLI expressing plasmidDepositorInsertApaLI restriction enzyme with N-terminal COX8 mitochondrial localization signal
UseLentiviralTagsFLAGExpressionMammalianPromotertight TRE promoterAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28_WT-LGP2 (codon optimized)
Plasmid#248163PurposeExpresses full-length human LGP2 in E. coliDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV NA 3C FLAG SA
Plasmid#234993PurposeExpression of transmembrane region of Neuraminidase protein fused to streptavidin protein for displaying on viral like particles (VLPs) when cotranfected with GAG proteinDepositorInsertNA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25H
Plasmid#91145PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9 + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1D/mEGFP + CrPV IGR IRES-nLuc-3XFLAG-CL1PEST
Plasmid#127332PurposeExpress 3xFLAG tagged highly destabilized nanoLuciferase (nLuc) protein from CrPV IRESDepositorInsertnanoLuciferase
Tags3xFLAG and CL1/PESTExpressionMammalianPromoterCMVAvailable SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only