We narrowed to 80,166 results for: ELL
-
Plasmid#140749PurposeInducibly expresses Bcl-xL in mammalian cellsDepositorAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only
-
PGK-IKZF3-CTERM-GFP
Plasmid#185779PurposeDegron-GFP fusion plasmid with restriction sites BamH1 and EcoR1 around GFP for subcloningDepositorInsertGFP
UseLentiviralTagsV5, IKZF3 minidegronMutationnonePromoterPGKAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-H2BC11
Plasmid#227332PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Homology Arms flanking a mStayGold-2A-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
SFFV-IKZF3-CTERM-GFP
Plasmid#185769PurposeDegron-GFP fusion plasmid with restriction sites BamH1 and EcoR1 around GFP for subcloningDepositorInsertGFP
UseLentiviralTagsV5, IKZF3 minidegronMutationnonePromoterSFFVAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash1
Plasmid#74129PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 40 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash4
Plasmid#74132PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 225 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash3
Plasmid#74131PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 171 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Rlucrarr3-Flash2
Plasmid#74130PurposeFlAsH-BRET reporter to monitor conformational changes in Arrestin3. Insertion of FlAsH motif (CCPGCC) following amino acid residue 139 of Arrestin3.DepositorInsertArrestin3
TagsRenilla luciferase (rLuc)ExpressionMammalianMutationInsertion of FlAsH motif (CCPGCC) following amino…Available SinceApril 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
PGK-AID-CTERM-GFP
Plasmid#185778PurposeDegron-GFP fusion plasmid with restriction sites BamH1 and EcoR1 around GFP for subcloningDepositorInsertGFP
UseLentiviralTagsV5, AIDMutationnonePromoterPGKAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CD200-Cd4d3+4-COMP-blac-3xFLAG-6his
Plasmid#71471PurposeA positive control receptor prey (rat CD200) EXPRESs plasmid for The Basic AVEXIS kitDepositorInsertCD200 (Cd200 Rat)
Tags6xHis tag, Cd4d3+4, beta-lactamase, and triple FL…ExpressionMammalianPromoterCMVAvailable SinceMarch 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-IRSp53
Plasmid#221317PurposeDox-inducible expression of IRSp53 in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMmaPylT(UUA)_EF1_MmaPylRS
Plasmid#174896PurposeMma PylRS expression for ochre suppression in mammalian cells; transient or piggy bac mediated integrationDepositorAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFFV-DTAG-CTERM-GFP
Plasmid#185765PurposeDegron-GFP fusion plasmid with restriction sites BamH1 and EcoR1 around GFP for subcloningDepositorInsertGFP
UseLentiviralTagsV5, dTAGMutationnonePromoterSFFVAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFUW-TetO-ETV6
Plasmid#131594Purposedoxycycline-inducible expression of human ETV6 in mammalian cellsDepositorAvailable SinceDec. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRK5 FLAG human DEPTOR
Plasmid#21334DepositorInsertDEPTOR (DEPTOR Human)
TagsFLAGExpressionMammalianMutationN204S and S389N mutations (numbering according to…Available SinceJune 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
PGK-SMASH-NTERM-GFP
Plasmid#185771PurposeDegron-GFP fusion plasmid with restriction sites BamH1 and EcoR1 around GFP for subcloningDepositorInsertGFP
UseLentiviralTagsV5, SMAShMutationnonePromoterPGKAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
ER-mGreenLantern
Plasmid#164463PurposeLocalization and retention of mGreenLantern fluorescent protein in the ERDepositorInsertmGreenLantern
TagsCalreticulin and KDELExpressionMammalianMutationClover-F64L/S72A/E124V/N149K/I167T/S175G/A206K/L2…PromoterCMVAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHBS1449 SED1-Lenti
Plasmid#180824PurposeSED1 biosensor for stable integration and expression in mammalian cellsDepositorInsertSED1 osmosensor
UseLentiviralPromoterCMVAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -