We narrowed to 10,976 results for: esp
-
Plasmid#163337PurposeRetroviral vector to overexpress the murine CD3 (TCR) components CD3 gamma, CD delta, CD epsilon and TCR zeta and surface marker CD90.2, separated by T2; F2A; E2A; P2A respectively, under control of the mPGK promoterDepositorInsertCD3
UseRetroviralExpressionMammalianPromotermPGKAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-hFTH1-CD3-P2A-CD90.2
Plasmid#163335PurposeRetroviral vector to overexpress the murine CD3 (TCR) components CD3 gamma, CD delta, CD epsilon and TCR zeta and surface marker CD90.2, separated by T2; F2A; E2A; P2A respectively, under control of the hFTH1 promoterDepositorInsertCD3
UseRetroviralExpressionMammalianPromoterhFTH1Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQE30-VRN1-R249E-R289E-R296E
Plasmid#159532PurposeExpresses Arabidopsis thaliana VERNALIZATION1 mutant, with R249E, R289E and R296E mutations, in E. coliDepositorInsertVERNALIZATION1 (VRN1 Mustard Weed)
TagsSix-Histidine tagExpressionBacterialMutationThree charge reversal mutations, namely R249E R28…PromoterT5Available SinceDec. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-ELP-ddFLN4-XMod-Doc-HIS (BMB-KO)
Plasmid#153441PurposeE. coli expression of Rc. XDocB binding mode B knock-out construct containing ybbr tag, ELP linker and ddFLN4 fingerprint domain. This construct was designed for AFM measurements.DepositorInsertRc. XDocB binding mode B knock-out mutant
Tags3xELP linker, 6xHis, ddFLN4 fingerprint domain, a…ExpressionBacterialMutationArginine 140 and methionine 144 were mutated to a…PromoterT7 promoterAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hs-EGR1
Plasmid#52724Purposeretroviral expression of human EGR1DepositorAvailable SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DY2230AA
Plasmid#64878Purposelentiviral expression of human POLQ -DY2230AA mutant (a polymerase domain mutant)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationD2330A,Y2331A, in the DNA polymerase domain (POL)…PromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nluc CD63
Plasmid#242528PurposeThis plasmid can be used to quantify CD63 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
anxA2-GFP
Plasmid#107196PurposeExpresses human annexin A2-GFP fusion protein for live cell imagingDepositorInsertannexin A2 (ANXA2 Human)
TagsGreen Fluorescent ProteinExpressionMammalianMutationAla residue 65 in human sequence replaced by Glu …PromoterCMVAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTubb3-MC
Plasmid#87112Purposeminicircle parental backbone plasmid including GFP knock-in donor targeting Tubb3 gene and one cutting site for HITIDepositorInsertGFP
UseCRISPRAvailable SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαs-LgB113
Plasmid#134362PurposeNanoluc complementation assay. Expression of Gαs protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 113 and 114 of Gαs. Addition of the HA epitope at N terminus of Gαs.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
TERT - WT
Plasmid#213827PurposeExpresses human telomerase reverse transcriptase, the catalytic subunit of telomeraseDepositorInserthuman TERT (TERT Human)
UseLentiviralExpressionMammalianPromoterTet-responsive promoter PTight, consisting of sev…Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4-AARE-luc2P-Hygro
Plasmid#101787PurposeLuferase reporter plasmid containing three tandem repeats of the amino acid response element (AARE)DepositorInsert3xAARE
UseLuciferaseTagsLuciferaseExpressionMammalianPromoterminimal TATA-box promoter with low basal activityAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE-8XGTIIC-DsRED-DD
Plasmid#115798Purposelentiviral, trimethoprim (TMP) regulated YAP promoter activity reporterDepositorAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
TERT - R865C
Plasmid#213926PurposeExpresses Mutant TERT R865CDepositorInsertMutant TERT R865C (TERT Human)
UseLentiviralTags6x His TagExpressionMammalianMutationArginine 865 changed to CysteinePromoterTet-responsive promoter PTight, consisting of sev…Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_epegRNA_entry-mpknot_(LM1140)
Plasmid#228253PurposepU6 entry plamid for cloning prime editor mpknot epegRNAs (requires BsmBI or Esp3I digest and ligation of duplexed oligos)DepositorInsertmpknot entry plasmid backbone for epegRNA expression via human U6 promoter
ExpressionMammalianMutationn/aPromoterU6Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
Nluc CD9
Plasmid#247322PurposeThis plasmid can be used to quantify CD9 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEN114 - pCAGGS-Tir1-V5-BpA-Frt-PGK-EM7-PuroR-bpA-Frt-Rosa26
Plasmid#92143PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse Rosa26 locus using Puromycin selection. Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-hHelios-IRES-GFP
Plasmid#74047Purposeretroviral plasmid for expression of FLAG-tagged human Helios (IKZF2) corresponding to cDNA from NM_001079526.1DepositorInserthuman Helios (IKZF2) (IKZF2 )
UseRetroviralTagsFLAGExpressionMammalianMutationencodes shorter version of human HeliosPromoterpMSCV-LTRsAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only