We narrowed to 16,688 results for: GRN
-
Plasmid#131502PurposeEndogenous tagging of WASP1/WAVE1: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pspCas9-POLI-ST2-com vector
Plasmid#176234PurposeVector plasmid for expressing spCas9-POLI fusion protein and sgRNA. There are two copies of HBB 3’ UTR in the 3’UTR of spCas9-POLI to enhance expression. The ST2 loop of the sgRNA scaffold was replaceDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-evoA1-seBEN_empty
Plasmid#174701PurposeSmall-molecule controlled base editingDepositorInsertLenti-evoA1-seBEN
UseLentiviralTagsmyc tagPromoterEFS/U6Available SinceNov. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21B
Plasmid#91129PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9_dead + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9_dead + AtU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
HeFm2SpCas9
Plasmid#92111PurposeExpression plasmid for human codon-optimized increased fidelity HeFm2SpCas9 (without U6-sgRNA coding sequence)DepositorInsert“Highly enhanced Fidelity” mut2 SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_23D
Plasmid#91141PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:barDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
1098A=TI-pgSIT[sxl,bTub,Hasp70Bb-Cas9]
Plasmid#149426PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel sxl and bTub genes, and Hsp70Bb-Cas9-T2A-eGFP-p10.DepositorInsertsU6.3-gRNAs[Sxl, bTub]
Hsp70Bb-Cas9-T2A-eGFP-p10
UseCRISPRTagseGFPExpressionInsectAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Tbxa2r
Plasmid#170304PurposeA knock-out vector for the mouse Tbxa2rDepositorInsertA gRNA targeting the mouse Tbxa2r gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFA0055
Plasmid#131774PurposeGuide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer CASS5a guide (gCASS5a) and 5' sgRNA
ExpressionBacterial and YeastAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25I
Plasmid#91146PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25G
Plasmid#91144PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
BII-gR-PtW-eSpCas9
Plasmid#133357PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications). Provides gRNA and EspCas9 expressionDepositorInserteSpCas9
TagsHA-tagged eSpCas9ExpressionMammalianMutationeSpCas9 mutationsPromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha1 clone2
Plasmid#162120PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00013
Plasmid#172525PurposesgRNA against mouse Mr1DepositorAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2121
Plasmid#91065PurposeModule B, Promoter: GmUbi, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoterGmUbiAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2516
Plasmid#91084PurposeModule C, Promoter: At7SL, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterAt7SLAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
HSF1 KO
Plasmid#200207PurposegRNA for HSF1 KODepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgCTRL-hygro
Plasmid#199639PurposesgRNA control; induces CAS9 cutting in an intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21D
Plasmid#91131PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only