We narrowed to 17,871 results for: SHE
-
Plasmid#236878PurposeExpress NanoLuc(R)-KRAS WT in Mammalian Cells under a CMV promoterDepositorUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable sinceSept. 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable sinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mScarlet-3H (JDW 1513)
Plasmid#242551PurposeGateway middle entry clone containing H2B-mScarlet-3H; Nuclear red fluorescent reporterDepositorInsertmScarlet3-H
UseGateway subcloningTagsExpressionMutationPromoterAvailable sinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 a-syn A53T D115A mNeonGreen-3K-B11
Plasmid#232017PurposeBacterial expression of alpha synuclein A53T mutant, tagged with the final beta strand of mNeonGreen-3KDepositorInsertSNCA (SNCA Human)
UseTagsmNeonGreen-3K beta11ExpressionBacterialMutationAla53Thr Asp115AlaPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B
Plasmid#232000PurposeBicistronic expression of CHMP2B along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorInsertCHMP2B (CHMP2B Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B-Q165X
Plasmid#232001PurposeBicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorInsertCHMP2B (CHMP2B Human)
UseTagsExpressionMammalianMutationQ165XPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorInsertCHMP2B (CHMP2B Human)
UseTags3xHAExpressionMammalianMutationL4D F5DPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B-d55-96
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorInsertCHMP2B (CHMP2B Human)
UseLentiviralTagsFLAGExpressionMammalianMutationΔ55-96PromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorInsertCHMP2B-targeted sgRNA (CHMP2B Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SNCA-A53T-mClover3
Plasmid#215378PurposeExpression of the A53T mutant of alpha-synuclein with a C-terminal mClover3 tag.DepositorInsertSNCA (SNCA Human)
UseTagsmClover3 tagExpressionMammalianMutationAla53ThrPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SNCA-A53T-mRuby3
Plasmid#215379PurposeExpression of the A53T mutant of alpha-synuclein with a C-terminal mRuby3 tag.DepositorInsertSNCA (SNCA Human)
UseTagsmRuby3 tagExpressionMammalianMutationAla53ThrPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR197
Plasmid#240643PurposeExpression of the tri-cistronic construct NES-AmNeonGreen-P2A-mTurquoise2-NLS-T2A-mScarlet-I-PTS1 in Exaiptasia diaphana; In vitro transcription of the same construct via SP6 polymeraseDepositorInsertsAIPGENE865 promoter
SP6 promoter
AmNeonGreen
mTurquoise2
mScarlet-I
UseGene expression and genomic integration in fishTagsNES (from Exaiptasia diaphana MEK2), NLS (from SV…ExpressionMutationCodon-optimized for Exaiptasia diaphana, amino ac…PromoterAvailable sinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV-RFP-p2A-DAAO-NES
Plasmid#238920PurposeExpression of DAAO with a nuclear export signal and RFP as a reporter in mammalian cellsDepositorInsertRFP-p2A-DAAO-NES
UseAAVTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-2x-lns-DEST (JDW 1206)
Plasmid#229818PurposeA PiggyBac destination vector compatible with gateway with 2 core cHS4 insulators by each ITR siteDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-SV40
Plasmid#226453PurposeFor subcloning of SV40 promoter or for assays using M13 phageDepositorInsertSV40
UseCloning vectorTagsExpressionMutationNoPromoterAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP(N55D)-CNOT7-V5H6.MCh.Puro
Plasmid#209949PurposeIn mammalian cells expresses non-binding TP mutant fused to a CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) with a N55D mutation that i…ExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-(inactive)CNOT7-V5H6.MCh.Puro
Plasmid#209936PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6interaction)-V5H6.MCh.Puro
Plasmid#209940PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6NOT1interaction)-V5H6.MCh.Puro
Plasmid#209941PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 or NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1 and CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusNOT1interaction)-V5H6.MCh.Puro
Plasmid#209942PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only