We narrowed to 12,674 results for: nsf
-
Plasmid#112911PurposeExpress the PEST domain-replaced 48 kDa form of human dematin with a cleavable N-terminal GST tag and non-cleavable C-terminal 6-his tagDepositorInsertdematin (DMTN Human)
Tags6-his tag, Glutathione-S-Transferase, and preciss…ExpressionBacterialMutation89KSTSPPPSPEVWAD102 was replaced with 89KAAAGGGAG…PromoterT7Available SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-VTKS5-ChR2-YFP
Plasmid#178725PurposeAAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of ChR2-YFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)DepositorInsertChR2-YFP
UseAAVAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pATP416-pluxO5-ptetO7-crtYBI
Plasmid#165975PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and doxycycline in yeast expressing LuxTA and rtTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG-FLEX.SF-Venus-iGluSnFR.S72A
Plasmid#106191PurposeWeak affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.S72A
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: S72APromoterCAGAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap-FLEX.SF-Venus-iGluSnFR.A184V
Plasmid#106184PurposeMedium affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184V
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184VPromoterhSynapsinAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-saCas9-NLS-3xHA-bGHpa;U6::BsaI-sgRNA-Grpr1
Plasmid#175176PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting GrprDepositorInsertsgRNA-Grpr
UseAAV and CRISPRAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_3xFlag-6His-nsp15 (SARS-CoV-2)
Plasmid#169166PurposeBaculoviral transfer vector for the expression of SARS-CoV-2 nsp15 in insect cellsDepositorInsert3xFlag-6His-nsp15 (ORF1ab Synthetic, SARS-CoV-2)
Tags3xFlag-6HisExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
J7AAV-HDR Fah.2
Plasmid#73451PurposeJ7AAV-HDR U6sgFah.2 template2 to repair Fah mutationDepositorInsertFah (Fah Mouse)
UseAAVAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-TBG-FLAG-mRIPK1-S321A
Plasmid#115342PurposeLiver-specific adeno-associated viral delivery and mammalian expression of Flag-mRIPK1-S321ADepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1534 pscAAV mU6 shRNA(PKCd) CMV-IE Nuc-EYFP
Plasmid#135562PurposeAn AAV vector expressing shRNA vs rat PKCd and a nuclear EYFP reporterDepositorInsertsshRNA (mouse PKCd)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianPromoterCMV-IE and mU6Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-ALG13 (OTU, aa 216-353)
Plasmid#61414PurposeExpresses human ALG13 (OTU domain) in E. coli.DepositorInsertALG13 (Putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13) (ALG13 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-215 and aa 354-1137.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEMS2272
Plasmid#111898PurposessAAV genome with Ple342 (TUBB3 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pA
Plasmid#113697PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_HA-TALE(NG)-Tet1FL-NLS_2A_EGFP_W3SL
Plasmid#172195PurposeAAV sequence-specific control vector for TALE-Tet1FL-SID4X. Synapsin promoter for neuronal expression. C-terminal, self-cleaving EGFP marker.DepositorInsertHA-TALE(NG)-Tet1FL-NLS_2A_EGFP_W3SL
UseAAV and Mouse Targeting; TaleTagsHA, NLS, and T2A-EGFPExpressionMammalianMutationtranscription regulatory domain removedPromoterhSyn human synapsin (mammalian neuronal expressio…Available SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
J8AAV-HDR Ctnnb1.1
Plasmid#73452PurposeJ8AAV-HDR U6sgCtnnb1.1 templateDepositorInsertCtnnb1 (Ctnnb1 Mouse)
UseAAVAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-TBG-FLAG-mRIPK1-S321E
Plasmid#115343PurposeLiver-specific adeno-associated viral delivery and mammalian expression of Flag-mRIPK1-S321EDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-APLP1ICD-IRES-hrGFP
Plasmid#107546PurposeAAV-mediated expression of last 50 amino acids of APLP1 protein (APLP1ICD) and IRES-mediated co-expression of hrGFP to recognize labelled cellsDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-iLMO (slGLuc-Mac-EYFP)
Plasmid#114100Purposefusion protein of Gaussia luciferase variant superluminescent, Leptosphaeria maculans opsin, and enhanced yellow fluorescent protein for bioluminescent optogeneticsDepositorInsertGaussia luciferase, superluminescent; Leptosphaeria maculans opsin; EYFP
UseAAVExpressionMammalianPromoterhSynAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only