We narrowed to 29,279 results for: Tat
-
Plasmid#101040PurposeExpresses GFP-MYH9 construct (human myosin IIA) carrying mutation of serine 1916 to alanine, driven by CMV promoter. Thus inhibits PKC phosphorylation of the tail. Also carries S1915A mutation.DepositorInsertNon-muscle myosin IIA heavy chain (MYH9 Human)
TagsGFPExpressionMammalianMutationS1916A, S1917APromoterCMVAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUG-T2A-Pten
Plasmid#140738PurposeLentiviral vector to overexpress human PTEN and GFPDepositorAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α P405A/P531A-pBabe-Hygro
Plasmid#21676DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralExpressionMammalianMutationcDNA changed amino acids from wt: Proline 405 t…Available SinceSept. 4, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_2
Plasmid#155078PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Chronos-GFP
Plasmid#99232PurposeAAV-mediated expression of Chronos-GFP under the CAG promoter. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterCAGAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pL452-Sf3b1-K700E
Plasmid#90425Purposeselectable HDR vector to introduce K700E mutation within mus Sf3b1 gene (for use with sgSf3b1(T1) and pL452(hygro)-Sf3b1-K700K plasmids enabling generation of hemizygous K700E mutation)DepositorInsertSf3b1 - left and right homology arms (Sf3b1 Mouse)
UseHomology-directed repair vectorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti TMEM30A
Plasmid#171789Purposetransfer plasmid for lentiviral vector production expressing TMEM30ADepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-tdTomato
Plasmid#122101PurposeAAV-mediated expression of tdTomato under the EF1α promoter (1.1kb short version). tdTomato has codons varied to reduce recombination. Using SV40 pA signal.DepositorInserttdTomato
UseAAVTagsNAExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceJune 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-myc-his-BACH1 P47A
Plasmid#17644DepositorInsertBACH1 (BRIP1 Human)
TagsHis and MycExpressionMammalianMutationTo generate the tumor-associated mutant, the prol…Available SinceApril 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLV_iRFP_P2AT2A_mScarlet-I_Myl9
Plasmid#172474PurposeMammalian expression of myosin light chain (Myl9) tagged with mScarlet-I and cytoplasmic iRFP as a reference marker.DepositorInsertsUseLentiviralTagsmScarlet-IExpressionMammalianPromoterEF1alpha (with UCOE) and none (same transcript as…Available SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA1
Plasmid#138187Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA2
Plasmid#138188Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 Mouse, sequence: GTCGCTACCTACAGCCAGGA)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Cdkn1a_i1-ipUSEPR-TR657
Plasmid#228953PurposeKnockdown of Cdkn1a in mammalian cellsDepositorInsertsg_Cdkn1a_i1 (Cdkn1a Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shSNAI1
Plasmid#115467PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
TP63-T2A-Rox-EF1a-Rox-Venus-NLS repair template
Plasmid#167971PurposeTp63 reporter targeting repair templateDepositorInsertTp63 (TP63 Human)
UseCRISPR; Donor templateTagsVenusExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-FLEX-fwd[Chrimson-tdT]
Plasmid#59137PurposeExpression vector for Chrimson-tdTomato in a floxed/forward-reading, Cre-dependent manner (Cre turns gene off)DepositorInsertChrimson-tdTomato
UseCre/LoxTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-TYK2V678F-VSV
Plasmid#139349PurposeExpression of a gain of function TYK2-V678F protein (correspoding to JAK2-V617F)DepositorInsertTYK2 cDNA with 267nt of 5' UTR (TYK2 Human)
TagsVSVExpressionMammalianMutationV362F-V678FPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRY2-INPP5E
Plasmid#79562Purposeexpression of CRY2PHR fused to inositol 5-phosphatase domain of human INPP5E with mutated C-terminal CaaX-motifDepositorInsertINPP5E (INPP5E Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationC-terminal region, aa 214_644, C641A mutation to …PromoterCMVAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag2-Sox9 T236A
Plasmid#111455PurposeTransient expression of Flag-tagged human Sox9 with T236A mutationDepositorAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only