We narrowed to 16,565 results for: grna
-
Plasmid#124861PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
BII-Sh-PnGW
Plasmid#133359PurposePiggybac vector for shRNA-mediated knockdown, co-expressed with GFP-NLSDepositorInsertGFP-NLS
TagsHA-tagged GFPExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTAJAK-71 (pESC-NatMXsyn-USER)
Plasmid#78232PurposeEmpty vector, for the insertion of gRNA expression cassettes into the vector.DepositorTypeEmpty backboneExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXFokI-dCas9
Plasmid#60901PurposeDual Expression Vector for FokI-dCas9 and gRNADepositorTypeEmpty backboneUseCRISPRTags3XFLAGExpressionMammalianPromoterCBh and U6Available SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBK1290-AAV-dSaCas9
Plasmid#223139PurposeAAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTX1-SMN1-exon7-ESE1
Plasmid#126041PurposeIn-vitro-transcription of SMN1-exon7-ESE1 RNA in NMR tube for "Systems NMR" analysisDepositorInsertSMN1 exon7 ESE1
Available SinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hU6-mU6-BlasGO
Plasmid#136906PurposeLentivirus for base editing activatable Blasticidin resistance gene expression in mammalian cells. All in one vector with sgBlasGO.DepositorInsertBlasCyGO
UseLentiviralMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSuper mouse Dicer3
Plasmid#14778DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSAG1::CAS9-U6::sg290860-6
Plasmid#59855PurposeEncodes CAS9 nuclease (GFP fusion) under control of the Toxoplasma gondii SAG1 promotor. Vector also provides U6 controlled expression of a single guide RNA for CRISPR disruption of TGME49_290860.DepositorInsertCRISPR sg290860-6
UseCRISPR; ; toxoplasma gondiiAvailable SinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUB-Cas9-@GL1
Plasmid#86779PurposeDisruption of GLABROUS1 gene in Arabidopsis using CRISPR/Cas9DepositorInsertsgRNA against GLABROUS1
UseSynthetic BiologyExpressionPlantPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_186
Plasmid#133458PurposeU6 promoter expresses customizable Spyo-guide; PGK promoter expresses blasticidin resistance and 2A site provides EGFPDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-mCh-Oct4i
Plasmid#21906DepositorInsertOct4i
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 30, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSRP-mTAZ
Plasmid#31795DepositorInsertTAZ
UseRNAi and RetroviralPromoterRNA Pol-IIIAvailable SinceAug. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_SOX17_bKO
Plasmid#172225PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the centromeric human SOX17 CTCF-boundary.DepositorInsertsgRNA
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Suv39H1_2
Plasmid#36343DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
Geph CR shRNA
Plasmid#121068PurposeshRNA targeting the coding region of the gephyrin mRNADepositorInsertGPHN shRNA (Gphn Rat)
UseRNAiAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR-puro-Mff1 shRNA
Plasmid#37247DepositorAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -