We narrowed to 11,701 results for: phen
-
Plasmid#89371PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl D
Plasmid#89373PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
E1b-GFP-Tol2-Gateway dre SE-irf2bpl A
Plasmid#89370PurposeVector for reporter assay of one zebrafish super-enhancer regionDepositorInsertirf2bpl (irf2bpl Zebrafish)
Available SinceApril 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pThermoCas9i_ctrl
Plasmid#100982PurposeExpresses the catalytically inactive version of ThermoCas9 (Thermo(d)Cas9) and its sgRNA moduleDepositorInsertsCatalytically inactive variant of the Cas9 from the type IIc CRISPR-Cas sytem of Geobacillus thermodenitrificans T12 strain
ThermoCas9 single guide RNA expressing module
TagsNoneExpressionBacterialMutationchanged aspartate 8 to alanine and histidine 582 …PromoterB. coagulans DSM 1 pta promoter and B. smithii xy…Available SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER20-Tau
Plasmid#92201PurposeRetroviral overexpression vector (doxycycline-inducible) for TauDepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBFC0993
Plasmid#231993PurposeCRISPRi-ART plasmid encoding aTc-inducible dRfxCas13d and constitutive crRNA with negative control (RFP-targeting) spacerDepositorInsertsdRfxCas13d
crRNA with negative control (RFP-targeting) spacer
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and pTetAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBFC0984
Plasmid#231992PurposeCRISPRi-ART plasmid encoding aTc-inducible dRfxCas13d and constitutive crRNA with 2xBsaI spacer cloning siteDepositorInsertsdRfxCas13d
crRNA with 2xBsaI spacer
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and pTetAvailable SinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-pAzF[TAG]
Plasmid#164579PurposeMachinery plasmid containing two copies of the Mj pCNFRS and cognate tRNA for incorporation of pAzF, pCNF, or pENF at TAG codonsDepositorInsertsMj pCNFRS[TAG] (aaRS1)
Mj pCNFRS[TAG] (aaRS2)
Mj tRNA[TAG]
ExpressionBacterialMutationY32L L65V F108W Q109M D158G I159PPromoteraraBAD, glnS, and proKAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZL-Neo-Myr-Flag-DEST
Plasmid#15300Purposea Gateway-compatible retroviral destination vector which adds a myristoylation sequence and a FLAG tag to each introduced ORFDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRetroviralTagsFlag and MyrExpressionMammalianAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLX304-BCL-XL-Y195F
Plasmid#203573PurposeExpresses V5-tagged BCL-XL with partial drug resistance to A-1331852 in mammalian cells.DepositorInsertBCL2L1 (BCL2L1 Human)
UseLentiviralTagsV5-taggedExpressionMammalianMutationChanged Tyrosine 195 to Phenylalanine for partial…PromoterCMVAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-N1
Plasmid#125547PurposeGateway compatible N2H assay destination vector with N-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to n-terminus of Gatew…ExpressionBacterial and MammalianPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C1
Plasmid#125549PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment1DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 attached to c-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C2
Plasmid#125559PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to c-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-N2
Plasmid#125548PurposeGateway compatible N2H assay destination vector with N-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to n-terminus of Gatew…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBrain-ch-TOGKDP-GFP-shch-TOG
Plasmid#69113PurposeDual-promoter plasmid to express knockdown-proof human ch-TOG tagged with EGFP along with shRNA to knock down endogenous ch-TOG in mammalian cells.DepositorInsertsUseRNAiTagsEGFPExpressionMammalianMutationSilent mutations to confer shRNA resistance.PromoterCMVAvailable SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAC-VIOL
Plasmid#53087PurposeProduces the carotenoid violaxanthin in E. coli.DepositorInsertzep (ABA1 Mustard Weed)
UseLow copy number bacterial cloning vectorMutationLacks codons for the first 60 N-terminal amino ac…PromoterT7Available SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-ccdB-boxB-tBE-V5-mA3
Plasmid#171693PurposeExpresses tBE-V5-mA3 in mammalian cellsDepositorInsertccdB-sgRNA scaffold-boxB-tBE-V5-mA3
UseCRISPRExpressionMammalianPromoterU6 and EF1aAvailable SinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
GABA(A) receptor subunit a2SE
Plasmid#49169PurposepHluorin-tagged GABA A receptor subunit (alpha 2) produces minimal fluorescence during trafficking and a robust fluorescent signal at the cell surfaceDepositorInsertGABA(A) receptor subunit alpha-2 (GABRA2 Human)
TagsHA, bovine alpha 1 signal sequence, and pHGFP (pH…ExpressionMammalianMutationT343APromoterCMVAvailable SinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only